Carbonic Anhydrase IV cDNA ORF Clone, Mouse, untagged

Cat: MG50350-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Carbonic Anhydrase IV Reagents
CRO Services
Product recommended

All Carbonic Anhydrase IV Reagents
Carbonic Anhydrase IV cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
918 bp
Description
Full length Clone DNA of Mouse carbonic anhydrase 4.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Carbonic Anhydrase IV cDNA ORF Clone, Mouse, untagged Alternative Names
AW456718 cDNA ORF Clone, Mouse;Ca4 cDNA ORF Clone, Mouse;Car4 cDNA ORF Clone, Mouse;RP23-167D6.1 cDNA ORF Clone, Mouse
Carbonic Anhydrase IV Background Information

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase IV (CAIV) is a membrane-associated enzyme anchored to plasma membrane surfaces by a phosphatidylinositol glycan linkage. CAIV is a high-activity isozyme in CO2 hydration comparable to that of CAII. Furthermore, CAIV is more active in HCO3- dehydration than is CAII. However, the esterase activity of CAIV is decreased 150-fold compared to CAII.

Full Name
carbonic anhydrase IV
References
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Baird TT, et al. (1997) Catalysis and Inhibition of Human Carbonic Anhydrase IV. Biochemistry. 36 (9): 2669-78.
  • Carbonic Anhydrase IV cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Carbonic Anhydrase IV cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50350-ACG
    Carbonic Anhydrase IV Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50350-ACGLN
    Carbonic Anhydrase IV cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50350-ACR
    Carbonic Anhydrase IV cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50350-CF
    Carbonic Anhydrase IV cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50350-NF
    Carbonic Anhydrase IV cDNA ORF Clone, Mouse, C-His tag MG50350-CH
    Carbonic Anhydrase IV cDNA ORF Clone, Mouse, N-His tag MG50350-NH
    Carbonic Anhydrase IV cDNA ORF Clone, Mouse, C-HA tag MG50350-CY
    Carbonic Anhydrase IV cDNA ORF Clone, Mouse, N-HA tag MG50350-NY
    Carbonic Anhydrase IV cDNA ORF Clone, Mouse, C-Myc tag MG50350-CM
    Carbonic Anhydrase IV cDNA ORF Clone, Mouse, N-Myc tag MG50350-NM
    Carbonic Anhydrase IV qPCR Primer Pairs, Mouse MP200371

    Carbonic Anhydrase IV cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Carbonic Anhydrase IV cDNA ORF Clone in Cloning Vector, Human HG10472-M
    Carbonic Anhydrase IV cDNA ORF Clone, Human, untagged HG10472-UT
    Carbonic Anhydrase IV Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10472-ACGLN
    Carbonic Anhydrase IV cDNA ORF Clone, Human, C-GFPSpark® tag HG10472-ACG
    Carbonic Anhydrase IV cDNA ORF Clone, Human, C-OFPSpark® tag HG10472-ACR
    Carbonic Anhydrase IV cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10472-CF
    Carbonic Anhydrase IV cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10472-NF
    Carbonic Anhydrase IV cDNA ORF Clone, Human, C-His tag HG10472-CH
    Carbonic Anhydrase IV cDNA ORF Clone, Human, N-His tag HG10472-NH
    Carbonic Anhydrase IV cDNA ORF Clone, Human, C-HA tag HG10472-CY
    Carbonic Anhydrase IV cDNA ORF Clone, Human, N-HA tag HG10472-NY
    Carbonic Anhydrase IV cDNA ORF Clone, Human, C-Myc tag HG10472-CM
    Carbonic Anhydrase IV cDNA ORF Clone, Human, N-Myc tag HG10472-NM
    Carbonic Anhydrase IV qPCR Primer Pairs, Human HP100494
    info info
    添加购物车成功! 添加购物车失败!