CTRP4/C1QTNF4 cDNA ORF Clone, Mouse, C-His tag

Cat: MG52364-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CTRP4/C1QTNF4 Reagents
CRO Services
Product recommended

All CTRP4/C1QTNF4 Reagents
CTRP4/C1QTNF4 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
981 bp
Description
Full length Clone DNA of Mouse C1q and tumor necrosis factor related protein 4 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CTRP4/C1QTNF4 cDNA ORF Clone, Mouse, C-His tag Alternative Names
0710001E10Rik cDNA ORF Clone, Mouse;9430004J15Rik cDNA ORF Clone, Mouse;CTRP4 cDNA ORF Clone, Mouse
CTRP4/C1QTNF4 Background Information
Full Name
C1q and tumor necrosis factor related protein 4

CTRP4/C1QTNF4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CTRP4/C1QTNF4 cDNA ORF Clone in Cloning Vector, Mouse MG52364-G
CTRP4/C1QTNF4 cDNA ORF Clone, Mouse, untagged MG52364-UT
CTRP4/C1QTNF4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52364-ACGLN
CTRP4/C1QTNF4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52364-ACG
CTRP4/C1QTNF4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52364-ACR
CTRP4/C1QTNF4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52364-CF
CTRP4/C1QTNF4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52364-NF
CTRP4/C1QTNF4 cDNA ORF Clone, Mouse, N-His tag MG52364-NH
CTRP4/C1QTNF4 cDNA ORF Clone, Mouse, C-HA tag MG52364-CY
CTRP4/C1QTNF4 cDNA ORF Clone, Mouse, N-HA tag MG52364-NY
CTRP4/C1QTNF4 cDNA ORF Clone, Mouse, C-Myc tag MG52364-CM
CTRP4/C1QTNF4 cDNA ORF Clone, Mouse, N-Myc tag MG52364-NM
CTRP4/C1QTNF4 qPCR Primer Pairs, Mouse MP202237

CTRP4/C1QTNF4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CTRP4/C1QTNF4 cDNA ORF Clone in Cloning Vector, Human HG13181-G
CTRP4/C1QTNF4 cDNA ORF Clone, Human, untagged HG13181-UT
CTRP4/C1QTNF4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13181-ACGLN
CTRP4/C1QTNF4 cDNA ORF Clone, Human, C-GFPSpark® tag HG13181-ACG
CTRP4/C1QTNF4 cDNA ORF Clone, Human, C-OFPSpark® tag HG13181-ACR
CTRP4/C1QTNF4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13181-CF
CTRP4/C1QTNF4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13181-NF
CTRP4/C1QTNF4 cDNA ORF Clone, Human, C-His tag HG13181-CH
CTRP4/C1QTNF4 cDNA ORF Clone, Human, N-His tag HG13181-NH
CTRP4/C1QTNF4 cDNA ORF Clone, Human, C-HA tag HG13181-CY
CTRP4/C1QTNF4 cDNA ORF Clone, Human, N-HA tag HG13181-NY
CTRP4/C1QTNF4 cDNA ORF Clone, Human, C-Myc tag HG13181-CM
CTRP4/C1QTNF4 cDNA ORF Clone, Human, N-Myc tag HG13181-NM
CTRP4/C1QTNF4 qPCR Primer Pairs, Human HP101767
info info
添加购物车成功! 添加购物车失败!