C1D cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52866-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All C1D Reagents
CRO Services
Product recommended

All C1D Reagents
C1D cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
426 bp
Description
Full length Clone DNA of Mouse C1D nuclear receptor co-repressor with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

C1D cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
1110036E10Rik cDNA ORF Clone, Mouse;AI875855 cDNA ORF Clone, Mouse;SUN-CoR cDNA ORF Clone, Mouse
C1D Background Information

C1D nuclear receptor corepressor belongs to the C1D family. It is a DNA binding and apoptosis-inducing protein.C1D nuclear receptor corepressorinteracts with TSNAX and DNA-PKcs. It acts as a corepressor for the thyroid hormone receptor. It is thought that C1D nuclear receptor corepressor regulates TRAX/Translin complex formation. It is expressed in kidney, heart, brain, spleen, lung, testis, liver and small intestine. It plays a role in the recruitment of the RNA exosome complex to pre-rRNA to mediate the 3'-5' end processing of the 5.8S rRNA; this function may include MPHOSPH6. It potentiates transcriptional repression by NR1D1 and THRB. C1D nuclear receptor corepressorcan activate PRKDC not only in the presence of linear DNA but also in the presence of supercoiled DNA. It also can induce apoptosis in a p53/TP53 dependent manner.

Full Name
C1D nuclear receptor corepressor
References
  • Schilders G, et al. (2007) C1D is a major autoantibody target in patients with the polymyositis-scleroderma overlap syndrome. Arthritis Rheum.56(7):2449-54.
  • Schilders G, et al. (2007) C1D and hMtr4p associate with the human exosome subunit PM/Scl-100 and are involved in pre-rRNA processing. Nucleic Acids Res. 35(8):2564-72.
  • Erdemir T, et al. (2002) DNA damage-dependent interaction of the nuclear matrix protein C1D with Translin-associated factor X (TRAX). J Cell Sci. 115(Pt 1):207-16.
  • info info
    添加购物车成功! 添加购物车失败!