After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse C1D Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse C1D cDNA Clone Product Information
NCBI RefSeq:NM_020558.3
RefSeq ORF Size:426bp
cDNA Description:Full length Clone DNA of Mus musculus C1D nuclear receptor co-repressor with N terminal HA tag.
Gene Synonym:SUN-CoR, AI875855, 1110036E10Rik
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

C1D nuclear receptor corepressor belongs to the C1D family. It is a DNA binding and apoptosis-inducing protein.C1D nuclear receptor corepressorinteracts with TSNAX and DNA-PKcs. It acts as a corepressor for the thyroid hormone receptor. It is thought that C1D nuclear receptor corepressor regulates TRAX/Translin complex formation. It is expressed in kidney, heart, brain, spleen, lung, testis, liver and small intestine. It plays a role in the recruitment of the RNA exosome complex to pre-rRNA to mediate the 3'-5' end processing of the 5.8S rRNA; this function may include MPHOSPH6. It potentiates transcriptional repression by NR1D1 and THRB. C1D nuclear receptor corepressorcan activate PRKDC not only in the presence of linear DNA but also in the presence of supercoiled DNA. It also can induce apoptosis in a p53/TP53 dependent manner.

References
  • Schilders G, et al. (2007) C1D is a major autoantibody target in patients with the polymyositis-scleroderma overlap syndrome. Arthritis Rheum.56(7):2449-54.
  • Schilders G, et al. (2007) C1D and hMtr4p associate with the human exosome subunit PM/Scl-100 and are involved in pre-rRNA processing. Nucleic Acids Res. 35(8):2564-72.
  • Erdemir T, et al. (2002) DNA damage-dependent interaction of the nuclear matrix protein C1D with Translin-associated factor X (TRAX). J Cell Sci. 115(Pt 1):207-16.
  • Size / Price
    Catalog: MG52866-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"