BTK cDNA ORF Clone, Mouse, C-His tag

Cat: MG50607-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BTK Reagents
CRO Services
Product recommended

All BTK Reagents
BTK cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1980 bp
Description
Full length Clone DNA of Mouse Bruton agammaglobulinemia tyrosine kinase with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BTK cDNA ORF Clone, Mouse, C-His tag Alternative Names
AI528679 cDNA ORF Clone, Mouse;xid cDNA ORF Clone, Mouse
BTK Background Information

Bruton's tyrosine kinase (or BTK) is a type of kinase protein expressed in B lymphocytes and T cells. BTK contains a PH domain which binds phosphatidylinositol(3,4,5)-trisphosphate (PIP3). After binding to PIP3, BTK is induced to phosphorylate phospholipase C, which in turn hydrolyzes PIP2 into two second messagers, IP3 and DAG, which then modulate the activity of downstream proteins during B-cell signaling. Btk is also found implicated in the primary immunodeficiency disease X-linked agammaglobulinemia(Bruton's agammaglobulinemia). BTK played a key role in B-cell maturation as well as mast cell activation through the high-affinity IgE receptor. Patients with X-linked agammaglobulinemia have normal pre-B cell populations in their bone marrow but these B-cells can not mature and enter the circulation.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
Bruton agammaglobulinemia tyrosine kinase
References
  • Hashimoto S, et al. (1996) Identification of Bruton's tyrosine kinase (Btk) gene mutations and characterization of the derived proteins in 35 X-linked agammaglobulinemia families: a nationwide study of Btk deficiency in Japan. Blood. 88(2): 561-73.
  • Ohta Y, et al. (1994) Genomic organization and structure of Bruton agammaglobulinemia tyrosine kinase: localization of mutations associated with varied clinical presentations and course in X chromosome-linked agammaglobulinemia. PNAS. 91(19): 9062-6.
  • Smith C, et al. (1994) Expression of Bruton's agammaglobulinemia tyrosine kinase gene, BTK, is selectively down-regulated in T lymphocytes and plasma cells. The Journal of Immunology. 152(2): 557-65.
  • BTK cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    BTK cDNA ORF Clone in Cloning Vector, Mouse MG50607-M
    BTK cDNA ORF Clone, Mouse, untagged MG50607-UT
    BTK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50607-ACGLN
    BTK cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50607-ACG
    BTK cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50607-ANG
    BTK cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50607-ACR
    BTK cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50607-ANR
    BTK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50607-CF
    BTK cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50607-NF
    BTK cDNA ORF Clone, Mouse, N-His tag MG50607-NH
    BTK cDNA ORF Clone, Mouse, C-HA tag MG50607-CY
    BTK cDNA ORF Clone, Mouse, N-HA tag MG50607-NY
    BTK cDNA ORF Clone, Mouse, C-Myc tag MG50607-CM
    BTK cDNA ORF Clone, Mouse, N-Myc tag MG50607-NM
    BTK qPCR Primer Pairs, Mouse MP200593

    BTK cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    BTK cDNA ORF Clone in Cloning Vector, Human HG10578-M
    BTK cDNA ORF Clone, Human, untagged HG10578-UT
    BTK Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10578-ACGLN
    BTK cDNA ORF Clone, Human, C-GFPSpark® tag HG10578-ACG
    BTK cDNA ORF Clone, Human, N-GFPSpark® tag HG10578-ANG
    BTK cDNA ORF Clone, Human, C-OFPSpark® tag HG10578-ACR
    BTK cDNA ORF Clone, Human, N-OFPSpark® tag HG10578-ANR
    BTK cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10578-CF
    BTK cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10578-NF
    BTK cDNA ORF Clone, Human, C-His tag HG10578-CH
    BTK cDNA ORF Clone, Human, N-His tag HG10578-NH
    BTK cDNA ORF Clone, Human, C-HA tag HG10578-CY
    BTK cDNA ORF Clone, Human, N-HA tag HG10578-NY
    BTK cDNA ORF Clone, Human, C-Myc tag HG10578-CM
    BTK cDNA ORF Clone, Human, N-Myc tag HG10578-NM
    BTK qPCR Primer Pairs, Human HP100857
    info info
    添加购物车成功! 添加购物车失败!