After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse BTK cDNA Clone Product Information
NCBI RefSeq:NM_013482.2
RefSeq ORF Size:1980bp
cDNA Description:Full length Clone DNA of Mus musculus Bruton agammaglobulinemia tyrosine kinase with C terminal Myc tag.
Gene Synonym:xid, AI528679, Btk
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-Myc tag on other vectors
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG50607-ACG$245
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG50607-ACR$245
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG50607-ANG$245
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG50607-ANR$245
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-Flag tagMG50607-CF$215
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-His tagMG50607-CH$215
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-Myc tagMG50607-CM$215
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-HA tagMG50607-CY$215
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone in cloning vectorMG50607-M$75
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-Flag tagMG50607-NF$215
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-His tagMG50607-NH$215
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-Myc tagMG50607-NM$215
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-HA tagMG50607-NY$215
Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmidMG50607-UT$215
 Learn more about expression Vectors
Product nameProduct name
Background

Bruton's tyrosine kinase (or BTK) is a type of kinase protein expressed in B lymphocytes and T cells. BTK contains a PH domain which binds phosphatidylinositol(3,4,5)-trisphosphate (PIP3). After binding to PIP3, BTK is induced to phosphorylate phospholipase C, which in turn hydrolyzes PIP2 into two second messagers, IP3 and DAG, which then modulate the activity of downstream proteins during B-cell signaling. Btk is also found implicated in the primary immunodeficiency disease X-linked agammaglobulinemia(Bruton's agammaglobulinemia). BTK played a key role in B-cell maturation as well as mast cell activation through the high-affinity IgE receptor. Patients with X-linked agammaglobulinemia have normal pre-B cell populations in their bone marrow but these B-cells can not mature and enter the circulation.

References
  • Hashimoto S, et al. (1996) Identification of Bruton's tyrosine kinase (Btk) gene mutations and characterization of the derived proteins in 35 X-linked agammaglobulinemia families: a nationwide study of Btk deficiency in Japan. Blood. 88(2): 561-73.
  • Ohta Y, et al. (1994) Genomic organization and structure of Bruton agammaglobulinemia tyrosine kinase: localization of mutations associated with varied clinical presentations and course in X chromosome-linked agammaglobulinemia. PNAS. 91(19): 9062-6.
  • Smith C, et al. (1994) Expression of Bruton's agammaglobulinemia tyrosine kinase gene, BTK, is selectively down-regulated in T lymphocytes and plasma cells. The Journal of Immunology. 152(2): 557-65.
  • Size / Price
    Catalog: MG50607-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"