Quick Order

Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse BTK cDNA Clone Product Information
    NCBI RefSeq:NM_013482.2
    RefSeq ORF Size:1980bp
    cDNA Description:Full length Clone DNA of Mus musculus Bruton agammaglobulinemia tyrosine kinase with C terminal HA tag.
    Gene Synonym:xid, AI528679, Btk
    Species:Mouse
    Vector:pCMV3-C-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with BTK qPCR primers for gene expression analysis, MP200593 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-HA tag on other vectors
    Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG50607-ACG$245
    Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG50607-ACR$245
    Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG50607-ANG$245
    Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG50607-ANR$245
    Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-Flag tagMG50607-CF$215
    Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-His tagMG50607-CH$215
    Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-Myc tagMG50607-CM$215
    Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-HA tagMG50607-CY$215
    Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone in cloning vectorMG50607-M$75
    Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-Flag tagMG50607-NF$215
    Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-His tagMG50607-NH$215
    Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-Myc tagMG50607-NM$215
    Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-HA tagMG50607-NY$215
    Mouse Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmidMG50607-UT$215
     Learn more about expression Vectors
    Product nameProduct name
    Background

    Bruton's tyrosine kinase (or BTK) is a type of kinase protein expressed in B lymphocytes and T cells. BTK contains a PH domain which binds phosphatidylinositol(3,4,5)-trisphosphate (PIP3). After binding to PIP3, BTK is induced to phosphorylate phospholipase C, which in turn hydrolyzes PIP2 into two second messagers, IP3 and DAG, which then modulate the activity of downstream proteins during B-cell signaling. Btk is also found implicated in the primary immunodeficiency disease X-linked agammaglobulinemia(Bruton's agammaglobulinemia). BTK played a key role in B-cell maturation as well as mast cell activation through the high-affinity IgE receptor. Patients with X-linked agammaglobulinemia have normal pre-B cell populations in their bone marrow but these B-cells can not mature and enter the circulation.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Hashimoto S, et al. (1996) Identification of Bruton's tyrosine kinase (Btk) gene mutations and characterization of the derived proteins in 35 X-linked agammaglobulinemia families: a nationwide study of Btk deficiency in Japan. Blood. 88(2): 561-73.
  • Ohta Y, et al. (1994) Genomic organization and structure of Bruton agammaglobulinemia tyrosine kinase: localization of mutations associated with varied clinical presentations and course in X chromosome-linked agammaglobulinemia. PNAS. 91(19): 9062-6.
  • Smith C, et al. (1994) Expression of Bruton's agammaglobulinemia tyrosine kinase gene, BTK, is selectively down-regulated in T lymphocytes and plasma cells. The Journal of Immunology. 152(2): 557-65.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"