BuB1 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG51033-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BuB1 Reagents
CRO Services
Product recommended

All BuB1 Reagents
BuB1 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
3177 bp
Description
Full length Clone DNA of Mouse budding uninhibited by benzimidazoles 1 homolog, beta (S. cerevisiae) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BuB1 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
AL022991 cDNA ORF Clone, Mouse;Bub1a cDNA ORF Clone, Mouse;C80208 cDNA ORF Clone, Mouse;D2Xrf87 cDNA ORF Clone, Mouse
BuB1 Background Information
Full Name
BUB1 mitotic checkpoint serine/threonine kinase

BuB1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BuB1 cDNA ORF Clone in Cloning Vector, Mouse MG51033-G
BuB1 cDNA ORF Clone, Mouse, untagged MG51033-UT
BuB1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51033-ACGLN
BuB1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51033-ACG
BuB1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51033-ANG
BuB1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51033-ACR
BuB1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51033-ANR
BuB1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51033-CF
BuB1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51033-NF
BuB1 cDNA ORF Clone, Mouse, C-His tag MG51033-CH
BuB1 cDNA ORF Clone, Mouse, N-His tag MG51033-NH
BuB1 cDNA ORF Clone, Mouse, C-HA tag MG51033-CY
BuB1 cDNA ORF Clone, Mouse, C-Myc tag MG51033-CM
BuB1 cDNA ORF Clone, Mouse, N-Myc tag MG51033-NM
BuB1 qPCR Primer Pairs, Mouse MP200992

BuB1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BuB1 cDNA ORF Clone in Cloning Vector, Human HG10775-G
BuB1 cDNA ORF Clone, Human, untagged HG10775-UT
BuB1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10775-ACGLN
BuB1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10775-ACG
BuB1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10775-ANG
BuB1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10775-ACR
BuB1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10775-ANR
BuB1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10775-CF
BuB1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10775-NF
BuB1 cDNA ORF Clone, Human, C-His tag HG10775-CH
BuB1 cDNA ORF Clone, Human, N-His tag HG10775-NH
BuB1 cDNA ORF Clone, Human, C-HA tag HG10775-CY
BuB1 cDNA ORF Clone, Human, N-HA tag HG10775-NY
BuB1 cDNA ORF Clone, Human, C-Myc tag HG10775-CM
BuB1 cDNA ORF Clone, Human, N-Myc tag HG10775-NM
BuB1 qPCR Primer Pairs, Human HP100695
info info
添加购物车成功! 添加购物车失败!