BTG2 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52875-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BTG2 Reagents
CRO Services
Product recommended

All BTG2 Reagents
BTG2 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
477 bp
Description
Full length Clone DNA of Mouse B cell translocation gene 2, anti-proliferative with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BTG2 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
AA959598 cDNA ORF Clone, Mouse;APRO1 cDNA ORF Clone, Mouse;Pc3 cDNA ORF Clone, Mouse;TIS21 cDNA ORF Clone, Mouse
BTG2 Background Information
Full Name
BTG family, member 2

BTG2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
BTG2 cDNA ORF Clone in Cloning Vector, Rat RG81582-G

BTG2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BTG2 cDNA ORF Clone in Cloning Vector, Mouse MG52875-G
BTG2 cDNA ORF Clone, Mouse, untagged MG52875-UT
BTG2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52875-ACGLN
BTG2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52875-ACG
BTG2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52875-ANG
BTG2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52875-ACR
BTG2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52875-ANR
BTG2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52875-CF
BTG2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52875-NF
BTG2 cDNA ORF Clone, Mouse, C-His tag MG52875-CH
BTG2 cDNA ORF Clone, Mouse, N-His tag MG52875-NH
BTG2 cDNA ORF Clone, Mouse, C-HA tag MG52875-CY
BTG2 cDNA ORF Clone, Mouse, N-HA tag MG52875-NY
BTG2 cDNA ORF Clone, Mouse, N-Myc tag MG52875-NM

BTG2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BTG2 cDNA ORF Clone in Cloning Vector, Human HG15607-G
BTG2 cDNA ORF Clone, Human, untagged HG15607-UT
BTG2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15607-ACGLN
BTG2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15607-ACG
BTG2 cDNA ORF Clone, Human, N-GFPSpark® tag HG15607-ANG
BTG2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15607-ACR
BTG2 cDNA ORF Clone, Human, N-OFPSpark® tag HG15607-ANR
BTG2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15607-CF
BTG2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15607-NF
BTG2 cDNA ORF Clone, Human, C-His tag HG15607-CH
BTG2 cDNA ORF Clone, Human, N-His tag HG15607-NH
BTG2 cDNA ORF Clone, Human, C-HA tag HG15607-CY
BTG2 cDNA ORF Clone, Human, N-HA tag HG15607-NY
BTG2 cDNA ORF Clone, Human, C-Myc tag HG15607-CM
BTG2 cDNA ORF Clone, Human, N-Myc tag HG15607-NM
BTG2 qPCR Primer Pairs, Human HP104226
info info
添加购物车成功! 添加购物车失败!