BST2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51043-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BST2 Reagents
CRO Services
Product recommended

All BST2 Reagents
BST2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
540 bp
Description
Full length Clone DNA of Mouse bone marrow stromal cell antigen 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BST2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
2310015I10Rik cDNA ORF Clone, Mouse;Bst-2 cDNA ORF Clone, Mouse;C87040 cDNA ORF Clone, Mouse;CD317 cDNA ORF Clone, Mouse;DAMP-1 cDNA ORF Clone, Mouse;GREG cDNA ORF Clone, Mouse
BST2 Background Information
Full Name
bone marrow stromal cell antigen 2
References
  • Ishikawa J, et al. (1995) Molecular cloning and chromosomal mapping of a bone marrow stromal cell surface gene, BST2, that may be involved in pre-B-cell growth. Genomics. 26 (3): 527-34.
  • Viswanathan K, et al. (2011) BST2/Tetherin enhances entry of human cytomegalovirus. PLoS Pathog. 7(11):e1002332.
  • Gifford RJ. (2011) No trespassing: ancient BST2 deletion confers protection against simian immunodeficiency virus infection of humans. Hum Mutat. 32(11).
  • BST2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    BST2 cDNA ORF Clone in Cloning Vector, Rat RG80417-G
    BST2 cDNA ORF Clone, Rat, untagged RG80417-UT
    BST2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80417-ACG
    BST2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80417-ACGLN
    BST2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80417-ACR
    BST2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80417-CF
    BST2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80417-NF
    BST2 cDNA ORF Clone, Rat, C-His tag RG80417-CH
    BST2 cDNA ORF Clone, Rat, N-His tag RG80417-NH
    BST2 cDNA ORF Clone, Rat, C-HA tag RG80417-CY
    BST2 cDNA ORF Clone, Rat, N-HA tag RG80417-NY
    BST2 cDNA ORF Clone, Rat, C-Myc tag RG80417-CM
    BST2 cDNA ORF Clone, Rat, N-Myc tag RG80417-NM
    BST2 qPCR Primer Pairs, Rat RP300381

    BST2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    BST2 cDNA ORF Clone in Cloning Vector, Mouse MG51043-G
    BST2 cDNA ORF Clone, Mouse, untagged MG51043-UT
    BST2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51043-ACG
    BST2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51043-ACGLN
    BST2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51043-ACR
    BST2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51043-NF
    BST2 cDNA ORF Clone, Mouse, C-His tag MG51043-CH
    BST2 cDNA ORF Clone, Mouse, N-His tag MG51043-NH
    BST2 cDNA ORF Clone, Mouse, C-HA tag MG51043-CY
    BST2 cDNA ORF Clone, Mouse, N-HA tag MG51043-NY
    BST2 cDNA ORF Clone, Mouse, C-Myc tag MG51043-CM
    BST2 cDNA ORF Clone, Mouse, N-Myc tag MG51043-NM
    BST2 qPCR Primer Pairs, Mouse MP201001

    BST2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    BST2 cDNA ORF Clone in Cloning Vector, Human HG13370-G
    BST2 cDNA ORF Clone, Human, untagged HG13370-UT
    BST2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13370-ACGLN
    BST2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13370-ACG
    BST2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13370-ACR
    BST2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13370-CF
    BST2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13370-NF
    BST2 cDNA ORF Clone, Human, C-His tag HG13370-CH
    BST2 cDNA ORF Clone, Human, N-His tag HG13370-NH
    BST2 cDNA ORF Clone, Human, C-HA tag HG13370-CY
    BST2 cDNA ORF Clone, Human, N-HA tag HG13370-NY
    BST2 cDNA ORF Clone, Human, C-Myc tag HG13370-CM
    BST2 cDNA ORF Clone, Human, N-Myc tag HG13370-NM
    BST2 qPCR Primer Pairs, Human HP102075
    info info
    添加购物车成功! 添加购物车失败!