BRF1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52571-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BRF1 Reagents
CRO Services
Product recommended

All BRF1 Reagents
BRF1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2031 bp
Description
Full length Clone DNA of Mouse BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BRF1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
2510002F24Rik cDNA ORF Clone, Mouse;GTF3B cDNA ORF Clone, Mouse;mTFIIIB90 cDNA ORF Clone, Mouse;TAF3C cDNA ORF Clone, Mouse;TAFIII90 cDNA ORF Clone, Mouse;TFIIIB90 cDNA ORF Clone, Mouse
BRF1 Background Information
Full Name
BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit

BRF1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BRF1 cDNA ORF Clone in Cloning Vector, Mouse MG52571-G
BRF1 cDNA ORF Clone, Mouse, untagged MG52571-UT
BRF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52571-ACG
BRF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52571-ACGLN
BRF1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52571-ANG
BRF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52571-ACR
BRF1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52571-ANR
BRF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52571-CF
BRF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52571-NF
BRF1 cDNA ORF Clone, Mouse, C-His tag MG52571-CH
BRF1 cDNA ORF Clone, Mouse, C-HA tag MG52571-CY
BRF1 cDNA ORF Clone, Mouse, N-HA tag MG52571-NY
BRF1 cDNA ORF Clone, Mouse, C-Myc tag MG52571-CM
BRF1 cDNA ORF Clone, Mouse, N-Myc tag MG52571-NM
BRF1 qPCR Primer Pairs, Mouse MP202443

BRF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BRF1 cDNA ORF Clone in Cloning Vector, Human HG14690-G
BRF1 cDNA ORF Clone, Human, untagged HG14690-UT
BRF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14690-ACG
BRF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14690-ACGLN
BRF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14690-ANG
BRF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14690-ACR
BRF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14690-ANR
BRF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14690-CF
BRF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14690-NF
BRF1 cDNA ORF Clone, Human, C-His tag HG14690-CH
BRF1 cDNA ORF Clone, Human, N-His tag HG14690-NH
BRF1 cDNA ORF Clone, Human, C-HA tag HG14690-CY
BRF1 cDNA ORF Clone, Human, N-HA tag HG14690-NY
BRF1 cDNA ORF Clone, Human, C-Myc tag HG14690-CM
BRF1 cDNA ORF Clone, Human, N-Myc tag HG14690-NM
BRF1 qPCR Primer Pairs, Human HP103324
info info
添加购物车成功! 添加购物车失败!