Quick Order

Mouse BMP-5 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse BMP5 cDNA Clone Product Information
NCBI RefSeq:NM_007555.3
RefSeq ORF Size:1365bp
cDNA Description:Full length Clone DNA of Mus musculus bone morphogenetic protein 5 with N terminal HA tag.
Gene Synonym:se, AU023399, Bmp5
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Bone Morphogenetic Protein 5 (BMP-5) is a member of the structurally and functionally related bone morphogenetic proteins (BMPs) which constitute a novel subfamily of the transforming growth factor β (TGF-β) superfamily. In agreement with a possible role in the control of cell death, BMP-5 exhibited a regulated pattern of expression in the interdigital tissue. Transcripts of BMP-5 and BMP-5 protein were abundant within the cytoplasm of the fragmenting apoptotic interdigital cells in a way suggesting that delivery of BMPs into the tissue is potentiated during apoptosis. Gain-of-function experiments demonstrated that BMP-5 has the same effect as other interdigital BMPs inducing apoptosis in the undifferentiated mesoderm and growth in the prechondrogenic mesenchyme. BMP-5 is a member of the 60A subgroup of BMPs, other members of which have been shown to stimulate dendritic growth in central and peripheral neurons. The signaling pathway that mediates the dendrite-promoting activity of BMP-5 may involve binding to BMPR-IA and activation of Smad-1, and relative levels of BMP antagonists such as noggin and follistatin may modulate BMP-5 signaling. Since BMP-5 is expressed at relatively high levels not only in the developing but also the adult nervous system, these findings suggest the possibility that BMP-5 regulates dendritic morphology not only in the developing, but also the adult nervous system. BMP-5 may play important roles not only in myocardial differentiation, but also in the formation and maintenance of endocardial cushion tissue. Additionally, high expression level of BMP-5 has been detected in certain tumors of mesenchymal origin.

References
  • Yamagishi T, et al. (2001) Expression of bone morphogenetic protein-5 gene during chick heart development: possible roles in valvuloseptal endocardial cushion formation. Anat Rec. 264(4): 313-6.
  • Beck HN, et al. (2001) Bone morphogenetic protein-5 (BMP-5) promotes dendritic growth in cultured sympathetic neurons. BMC Neurosci. 2:12.
  • Zuzarte-Lus V, et al. (2004) A new role for BMP5 during limb development acting through the synergic activation of Smad and MAPK pathways. Dev Biol. 272(1): 39-52.
  • Size / Price
    Catalog: MG50703-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"