BLK cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50365-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BLK Reagents
CRO Services
Product recommended

All BLK Reagents
BLK cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1500 bp
Description
Full length Clone DNA of Mouse B lymphoid kinase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BLK Background Information

Tyrosine-protein kinase Blk, also known as B lymphocyte kinase, p55-Blk and BLK, is a member of the protein kinase superfamily, Tyr protein kinase family and SRC subfamily. BLK / p55-Blk is expressed in lymphatic organs, pancreatic islets, Leydig cells, striate ducts of salivary glands and hair follicles. BLK / p55-Blk is a src-family protein tyrosine kinase specifically expressed in B-lineage cells of mice. The early onset of Blk expression during B-cell development in the bone marrow and the high expression levels of Blk in mature B cells suggest a possible important role of Blk in B-cell physiology. It is a modulator of beta-cells function, acting through the up-regulation of PDX1 and NKX6-1 and consequent stimulation of insulin secretion in response to glucose. Defects in BLK are a cause of maturity-onset diabetes of the young type 11 which is a form of diabetes that is characterized by an autosomal dominant mode of inheritance, onset in childhood or early adulthood (usually before 25 years of age), a primary defect in insulin secretion and frequent insulin-independence at the beginning of the disease.

Full Name
BLK proto-oncogene, Src family tyrosine kinase
References
  • Dymecki,S.M. et al., 1992, J Biol Chem. 267 (7):4815-23.
  • Drebin J.A. et al., 1995, Oncogene 10:477-86.
  • Islam K.B.et al., 1995, J. Immunol. 154:1265-72.
  • Texido,G. et al., 2000, Mol Cell Biol. 20 (4):1227-33.
  • Borowiec M. et al., 2009, Proc. Natl. Acad. Sci. USA. 106: 14460-5.
  • BLK cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    BLK cDNA ORF Clone in Cloning Vector, Mouse MG50365-M
    BLK cDNA ORF Clone, Mouse, untagged MG50365-UT
    BLK cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50365-ACG
    BLK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50365-ACGLN
    BLK cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50365-ACR
    BLK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50365-CF
    BLK cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50365-NF
    BLK cDNA ORF Clone, Mouse, C-His tag MG50365-CH
    BLK cDNA ORF Clone, Mouse, N-His tag MG50365-NH
    BLK cDNA ORF Clone, Mouse, C-HA tag MG50365-CY
    BLK cDNA ORF Clone, Mouse, N-HA tag MG50365-NY
    BLK cDNA ORF Clone, Mouse, C-Myc tag MG50365-CM
    BLK qPCR Primer Pairs, Mouse MP200385

    BLK cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    BLK cDNA ORF Clone in Cloning Vector, Human HG10782-M
    BLK cDNA ORF Clone, Human, untagged HG10782-UT
    BLK cDNA ORF Clone, Human, C-GFPSpark® tag HG10782-ACG
    BLK Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10782-ACGLN
    BLK cDNA ORF Clone, Human, N-GFPSpark® tag HG10782-ANG
    BLK cDNA ORF Clone, Human, C-OFPSpark® tag HG10782-ACR
    BLK cDNA ORF Clone, Human, N-OFPSpark® tag HG10782-ANR
    BLK cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10782-CF
    BLK cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10782-NF
    BLK cDNA ORF Clone, Human, C-His tag HG10782-CH
    BLK cDNA ORF Clone, Human, N-His tag HG10782-NH
    BLK cDNA ORF Clone, Human, C-HA tag HG10782-CY
    BLK cDNA ORF Clone, Human, N-HA tag HG10782-NY
    BLK cDNA ORF Clone, Human, C-Myc tag HG10782-CM
    BLK cDNA ORF Clone, Human, N-Myc tag HG10782-NM
    BLK qPCR Primer Pairs, Human HP100700
    info info
    添加购物车成功! 添加购物车失败!