BLCAP cDNA ORF Clone, Mouse, C-His tag

Cat: MG52377-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BLCAP Reagents
CRO Services
Product recommended

All BLCAP Reagents
BLCAP cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
264 bp
Description
Full length Clone DNA of Mouse bladder cancer associated protein homolog (human) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BLCAP cDNA ORF Clone, Mouse, C-His tag Alternative Names
AI462828 cDNA ORF Clone, Mouse;Bc10 cDNA ORF Clone, Mouse
BLCAP Background Information
Full Name
bladder cancer associated protein

BLCAP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BLCAP cDNA ORF Clone in Cloning Vector, Mouse MG52377-G
BLCAP cDNA ORF Clone, Mouse, untagged MG52377-UT
BLCAP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52377-ACGLN
BLCAP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52377-ACG
BLCAP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52377-ANG
BLCAP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52377-ACR
BLCAP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52377-ANR
BLCAP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52377-CF
BLCAP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52377-NF
BLCAP cDNA ORF Clone, Mouse, N-His tag MG52377-NH
BLCAP cDNA ORF Clone, Mouse, C-HA tag MG52377-CY
BLCAP cDNA ORF Clone, Mouse, N-HA tag MG52377-NY
BLCAP cDNA ORF Clone, Mouse, C-Myc tag MG52377-CM
BLCAP cDNA ORF Clone, Mouse, N-Myc tag MG52377-NM
BLCAP qPCR Primer Pairs, Mouse MP202250

BLCAP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BLCAP cDNA ORF Clone in Cloning Vector, Human HG21202-U
BLCAP cDNA ORF Clone, Human, untagged HG21202-UT
BLCAP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21202-ACGLN
BLCAP cDNA ORF Clone, Human, C-GFPSpark® tag HG21202-ACG
BLCAP cDNA ORF Clone, Human, N-GFPSpark® tag HG21202-ANG
BLCAP cDNA ORF Clone, Human, C-OFPSpark® tag HG21202-ACR
BLCAP cDNA ORF Clone, Human, N-OFPSpark® tag HG21202-ANR
BLCAP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21202-CF
BLCAP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21202-NF
BLCAP cDNA ORF Clone, Human, C-His tag HG21202-CH
BLCAP cDNA ORF Clone, Human, N-His tag HG21202-NH
BLCAP cDNA ORF Clone, Human, C-HA tag HG21202-CY
BLCAP cDNA ORF Clone, Human, N-HA tag HG21202-NY
BLCAP cDNA ORF Clone, Human, C-Myc tag HG21202-CM
BLCAP cDNA ORF Clone, Human, N-Myc tag HG21202-NM
info info
添加购物车成功! 添加购物车失败!