After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse BGN ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse BGN cDNA Clone Product Information
NCBI RefSeq:NM_007542.4
RefSeq ORF Size:1110bp
cDNA Description:Full length Clone DNA of Mus musculus biglycan with N terminal His tag.
Gene Synonym:BG, PGI, DSPG1, PG-S1, SLRR1A
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-mBGN
Restriction Site:KpnI + XbaI (6kb + 1.15kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse BGN Gene Plasmid Map
Mouse BGN ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Biglycan, also known as PG-S1 and BGN, is a a small leucine-rich repeat proteoglycan (SLRP). It can be detected in a variety of extracellular matrix tissues, including bone, cartilage and tendon. Biglycan consists of a protein core containing leucine-rich repeat regions and two glycosaminoglycan (GAG) chains consisting of either chondroitin sulfate (CS) or dermatan sulfate (DS). Non-glycanated forms of biglycan (no GAG chains) increase with age in human articular cartilage. Biglycan interacts with collagen, both via the core protein and GAG chains. Biglycan plays a role in the mineralisation of bone. Biglycan core protein binds to the growth factors BMP-4 and influences its bioactivity.

Size / Price
Catalog: MG50766-NH
List Price:   (Save )
Price:      [How to order]
Availability
 Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"