BET1 cDNA ORF Clone, Mouse, untagged

Cat: MG52558-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BET1 Reagents
CRO Services
Product recommended

All BET1 Reagents
BET1 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
357 bp
Description
Full length Clone DNA of Mouse blocked early in transport 1 homolog (S. cerevisiae).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BET1 cDNA ORF Clone, Mouse, untagged Alternative Names
AW555236 cDNA ORF Clone, Mouse;Bet-1 cDNA ORF Clone, Mouse
BET1 Background Information
Full Name
Bet1 golgi vesicular membrane trafficking protein

BET1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
BET1 cDNA ORF Clone in Cloning Vector, Rat RG80530-U
BET1 cDNA ORF Clone, Rat, untagged RG80530-UT
BET1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80530-ACG
BET1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80530-ACGLN
BET1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80530-ACR
BET1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80530-CF
BET1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80530-NF
BET1 cDNA ORF Clone, Rat, C-His tag RG80530-CH
BET1 cDNA ORF Clone, Rat, N-His tag RG80530-NH
BET1 cDNA ORF Clone, Rat, C-HA tag RG80530-CY
BET1 cDNA ORF Clone, Rat, N-HA tag RG80530-NY
BET1 cDNA ORF Clone, Rat, C-Myc tag RG80530-CM
BET1 cDNA ORF Clone, Rat, N-Myc tag RG80530-NM
BET1 qPCR Primer Pairs, Rat RP300494

BET1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BET1 cDNA ORF Clone in Cloning Vector, Mouse MG52558-U
BET1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52558-ACG
BET1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52558-ACGLN
BET1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52558-ANG
BET1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52558-ACR
BET1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52558-ANR
BET1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52558-CF
BET1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52558-NF
BET1 cDNA ORF Clone, Mouse, C-His tag MG52558-CH
BET1 cDNA ORF Clone, Mouse, N-His tag MG52558-NH
BET1 cDNA ORF Clone, Mouse, C-HA tag MG52558-CY
BET1 cDNA ORF Clone, Mouse, N-HA tag MG52558-NY
BET1 cDNA ORF Clone, Mouse, C-Myc tag MG52558-CM
BET1 cDNA ORF Clone, Mouse, N-Myc tag MG52558-NM
BET1 qPCR Primer Pairs, Mouse MP202431

BET1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BET1 cDNA ORF Clone, Human, untagged HG22466-UT
info info
添加购物车成功! 添加购物车失败!