Beclin 1/BECN1 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50471-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Beclin 1/BECN1 Reagents
CRO Services
Product recommended

All Beclin 1/BECN1 Reagents
Beclin 1/BECN1 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1347 bp
Description
Full length Clone DNA of Mouse beclin 1, autophagy related with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Beclin 1/BECN1 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
4921513J16Rik cDNA ORF Clone, Mouse;5430417M23Rik cDNA ORF Clone, Mouse;Atg6 cDNA ORF Clone, Mouse
Beclin 1/BECN1 Background Information
Full Name
beclin 1, autophagy related

Beclin 1/BECN1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Beclin 1/BECN1 cDNA ORF Clone in Cloning Vector, Rat RG81369-G

Beclin 1/BECN1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Beclin 1/BECN1 cDNA ORF Clone in Cloning Vector, Mouse MG50471-G
Beclin 1/BECN1 cDNA ORF Clone, Mouse, untagged MG50471-UT
Beclin 1/BECN1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50471-ACGLN
Beclin 1/BECN1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50471-ACG
Beclin 1/BECN1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50471-ACR
Beclin 1/BECN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50471-CF
Beclin 1/BECN1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50471-NF
Beclin 1/BECN1 cDNA ORF Clone, Mouse, C-His tag MG50471-CH
Beclin 1/BECN1 cDNA ORF Clone, Mouse, N-His tag MG50471-NH
Beclin 1/BECN1 cDNA ORF Clone, Mouse, C-HA tag MG50471-CY
Beclin 1/BECN1 cDNA ORF Clone, Mouse, N-HA tag MG50471-NY
Beclin 1/BECN1 cDNA ORF Clone, Mouse, N-Myc tag MG50471-NM
Beclin 1/BECN1 qPCR Primer Pairs, Mouse MP200468

Beclin 1/BECN1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Beclin 1/BECN1 cDNA ORF Clone in Cloning Vector, Human HG11162-U
Beclin 1/BECN1 cDNA ORF Clone, Human, untagged HG11162-M-N
Beclin 1/BECN1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11162-ACG
Beclin 1/BECN1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11162-ACGLN
Beclin 1/BECN1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11162-ACR
Beclin 1/BECN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11162-CF
Beclin 1/BECN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11162-NF
Beclin 1/BECN1 cDNA ORF Clone, Human, C-HA tag HG11162-CY
Beclin 1/BECN1 cDNA ORF Clone, Human, C-Myc tag HG11162-CM
Beclin 1/BECN1 qPCR Primer Pairs, Human HP104868
info info
添加购物车成功! 添加购物车失败!