Quick Order

Mouse BDNF/ANON2 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse BDNF cDNA Clone Product Information
NCBI RefSeq:NM_001048139.1
RefSeq ORF Size:447bp
cDNA Description:Full length Clone DNA of Mus musculus brain derived neurotrophic factor with N terminal His tag.
Gene Synonym:Bdnf
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

BDNF is a member of the nerve growth factor family. It is highly expressed in hippocampus, amygdala, cerebral cortex and cerebellum. It also can be detected in heart, lung, skeletal muscle, testis, prostate and placenta. BDNF is induced by cortical neurons, and is necessary for survival of striatal neurons in the brain. During development, BDNF promotes the survival and differentiation of selected neuronal populations of the peripheral and central nervous systems. It participates in axonal growth, pathfinding and in the modulation of dendritic growth and morphology. It functions as the major regulator of synaptic transmission and plasticity at adult synapses in many regions of the CNS. The versatility of BDNF is emphasized by its contribution to a range of adaptive neuronal responses including long-term potentiation (LTP), long-term depression (LTD), certain forms of short-term synaptic plasticity, as well as homeostatic regulation of intrinsic neuronal excitability.

References
  • Zigova T, et al. (1998) Intraventricular administration of BDNF increases the number of newly generated neurons in the adult olfactory bulb. Mol Cell Neurosci. 11(4):234-45.
  • Acheson A, et al. (1995) A BDNF autocrine loop in adult sensory neurons prevents cell death. Nature 374(6521):450-3.
  • Bekinschtein P, et al. (2008) BDNF is essential to promote persistence of long-term memory storage. Proc Natl Acad Sci. 105(7):2711-6.
  • Size / Price
    Catalog: MG50240-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"