Bcl2A1 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50011-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Bcl2A1 Reagents
CRO Services
Product recommended

All Bcl2A1 Reagents
Bcl2A1 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
519 bp
Description
Full length Clone DNA of Mouse B-cell leukemia/lymphoma 2 related protein A1a with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Bcl2A1 Background Information
Full Name
BCL2 related protein A1

Bcl2A1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Bcl2A1 cDNA ORF Clone in Cloning Vector, Mouse MG50011-M
Bcl2A1 cDNA ORF Clone, Mouse, untagged MG50011-UT
Bcl2A1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50011-ACG
Bcl2A1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50011-ACGLN
Bcl2A1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50011-ANG
Bcl2A1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50011-ACR
Bcl2A1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50011-ANR
Bcl2A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50011-CF
Bcl2A1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50011-NF
Bcl2A1 cDNA ORF Clone, Mouse, C-His tag MG50011-CH
Bcl2A1 cDNA ORF Clone, Mouse, N-His tag MG50011-NH
Bcl2A1 cDNA ORF Clone, Mouse, N-HA tag MG50011-NY
Bcl2A1 cDNA ORF Clone, Mouse, C-Myc tag MG50011-CM
Bcl2A1 cDNA ORF Clone, Mouse, N-Myc tag MG50011-NM
Bcl2A1 qPCR Primer Pairs, Mouse MP200011

Bcl2A1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Bcl2A1 cDNA ORF Clone in Cloning Vector, Human HG10562-M
Bcl2A1 cDNA ORF Clone, Human, untagged HG10562-UT
Bcl2A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10562-ACGLN
Bcl2A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10562-ACG
Bcl2A1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10562-ANG
Bcl2A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10562-ACR
Bcl2A1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10562-ANR
Bcl2A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10562-CF
Bcl2A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10562-NF
Bcl2A1 cDNA ORF Clone, Human, C-His tag HG10562-CH
Bcl2A1 cDNA ORF Clone, Human, N-His tag HG10562-NH
Bcl2A1 cDNA ORF Clone, Human, C-HA tag HG10562-CY
Bcl2A1 cDNA ORF Clone, Human, N-HA tag HG10562-NY
Bcl2A1 cDNA ORF Clone, Human, C-Myc tag HG10562-CM
Bcl2A1 cDNA ORF Clone, Human, N-Myc tag HG10562-NM
Bcl2A1 qPCR Primer Pairs, Human HP100573
info info
添加购物车成功! 添加购物车失败!