Quick Order

Mouse Ctip1/BCL11A Gene ORF cDNA clone expression plasmid, N-His tag

  • Human PKM2 Gene Plasmid Map 5788
DatasheetReviewsRelated ProductsProtocols
Mouse BCL11A cDNA Clone Product Information
NCBI RefSeq:NM_001159290.1
RefSeq ORF Size:621 bp
cDNA Description:Full length Clone DNA of Mus musculus B cell CLL/lymphoma 11A (zinc finger protein) with N terminal His tag.
Gene Synonym:Evi9, Ctip1, Evi9a, Evi9b, Evi9c, BCL-11A, mKIAA1809, 2810047E18Rik, D930021L15Rik
Species:Mouse
Vector:pCMV3-N-His
Plasmid:PCMV3-His-mBCL11A
Restriction Site:KpnI + NotI(6kb+0.62kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with BCL11A qPCR primers for gene expression analysis, MP202424 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Catalog: MG52551-NH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"