Quick Order

Mouse BCHE/Butyrylcholinesterase Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse BCHE cDNA Clone Product Information
NCBI RefSeq:NM_009738.3
RefSeq ORF Size:1812bp
cDNA Description:Full length Clone DNA of Mus musculus butyrylcholinesterase.
Gene Synonym:MGC107651, C730038G20Rik, Bche
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Butyrylcholinesterase (BCHE), also known as cholinesterase or BuChE, is an enzyme defined as "pseudo" or "non-neuronal" cholinesterase. Butyrylcholinesterase (BCHE) is widely distributed in the nervous system as well as blood plasma. It is constitutively similar to the neuronal acetylcholinesterase, and is a non-specific cholinesterase which hydrolyses many different choline esters. Butyrylcholinesterase (BCHE) is a glycoprotein of 4 identical subunits, that were arranged as a dimer of dimers with each dimer composed of two identical subunits joined by interchain disulfide bonds. Butyrylcholinesterase (BCHE) behaves principally similar to the true enzyme and thus can play a similar role in nerve conduction, although it participates probably only in relatively slow conductive processes and could be involved in other nervous system functions and in neurodegenerative diseases. It can hydrolyze toxic esters such as cocaine or scavenge organophosphorus pesticides and nerve agents. Purified human serum cholinesterase combines in its active surface an anionic and an esteratic site, similar to true cholinesterase. It has been demonstrated that butyrylcholinesterase (BCHE) may have a greater role in cholinergic transmission than previously surmised, making BChE inhibition an important therapeutic goal in Alzheimer's disease.

References
  • Lockridge O. (1988) Structure of human serum cholinesterase. Bio Essays. 9(4):125-8.
  • Mesulam M, et al. (2002) Widely Spread Butyrylcholinesterase Can Hydrolyze Acetylcholine in the Normal and Alzheimer Brain. Neurobiology of Disease. 9(1): 88-93.
  • Nicolet Y, et al. (2003) Crystal Structure of Human Butyrylcholinesterase and of Its Complexes with Substrate and Products. The Journal of Biological Chemistry. 278: 41141-7.
  • Size / Price
    Catalog: MG50418-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"