BAP29 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51567-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BAP29 Reagents
CRO Services
Product recommended

All BAP29 Reagents
BAP29 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
723 bp
Description
Full length Clone DNA of Mouse B cell receptor associated protein 29 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BAP29 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
AW208404 cDNA ORF Clone, Mouse;Bap29 cDNA ORF Clone, Mouse
BAP29 Background Information
Full Name
B-cell receptor-associated protein 29

BAP29 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
BAP29 cDNA ORF Clone in Cloning Vector, Rat RG80567-U
BAP29 cDNA ORF Clone, Rat, untagged RG80567-UT
BAP29 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80567-ACGLN
BAP29 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80567-ACG
BAP29 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80567-ANG
BAP29 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80567-ACR
BAP29 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80567-ANR
BAP29 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80567-CF
BAP29 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80567-NF
BAP29 cDNA ORF Clone, Rat, C-His tag RG80567-CH
BAP29 cDNA ORF Clone, Rat, N-His tag RG80567-NH
BAP29 cDNA ORF Clone, Rat, C-HA tag RG80567-CY
BAP29 cDNA ORF Clone, Rat, N-HA tag RG80567-NY
BAP29 cDNA ORF Clone, Rat, C-Myc tag RG80567-CM
BAP29 cDNA ORF Clone, Rat, N-Myc tag RG80567-NM
BAP29 qPCR Primer Pairs, Rat RP300531

BAP29 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BAP29 cDNA ORF Clone in Cloning Vector, Mouse MG51567-G
BAP29 cDNA ORF Clone, Mouse, untagged MG51567-UT
BAP29 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51567-ACG
BAP29 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51567-ACGLN
BAP29 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51567-ANG
BAP29 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51567-ACR
BAP29 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51567-ANR
BAP29 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51567-CF
BAP29 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51567-NF
BAP29 cDNA ORF Clone, Mouse, C-His tag MG51567-CH
BAP29 cDNA ORF Clone, Mouse, N-His tag MG51567-NH
BAP29 cDNA ORF Clone, Mouse, C-HA tag MG51567-CY
BAP29 cDNA ORF Clone, Mouse, N-HA tag MG51567-NY
BAP29 cDNA ORF Clone, Mouse, C-Myc tag MG51567-CM
BAP29 qPCR Primer Pairs, Mouse MP201450

BAP29 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BAP29 cDNA ORF Clone in Cloning Vector, Human HG14247-G
BAP29 cDNA ORF Clone, Human, untagged HG14247-UT
BAP29 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14247-ACGLN
BAP29 cDNA ORF Clone, Human, C-GFPSpark® tag HG14247-ACG
BAP29 cDNA ORF Clone, Human, C-OFPSpark® tag HG14247-ACR
BAP29 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14247-CF
BAP29 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14247-NF
BAP29 cDNA ORF Clone, Human, C-His tag HG14247-CH
BAP29 cDNA ORF Clone, Human, N-His tag HG14247-NH
BAP29 cDNA ORF Clone, Human, C-HA tag HG14247-CY
BAP29 cDNA ORF Clone, Human, N-HA tag HG14247-NY
BAP29 cDNA ORF Clone, Human, C-Myc tag HG14247-CM
BAP29 cDNA ORF Clone, Human, N-Myc tag HG14247-NM
BAP29 qPCR Primer Pairs, Human HP102897
info info
添加购物车成功! 添加购物车失败!