Bak/BAK1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50764-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Bak/BAK1 Reagents
CRO Services
Product recommended

All Bak/BAK1 Reagents
Bak/BAK1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
630 bp
Description
Full length Clone DNA of Mouse BCL2-antagonist/killer 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Bak/BAK1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
Bak cDNA ORF Clone, Mouse;N-Bak cDNA ORF Clone, Mouse;N-BAK1 cDNA ORF Clone, Mouse
Bak/BAK1 Background Information
Full Name
BCL2-antagonist/killer 1

Bak/BAK1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Bak/BAK1 cDNA ORF Clone in Cloning Vector, Mouse MG50764-G
Bak/BAK1 cDNA ORF Clone, Mouse, untagged MG50764-UT
Bak/BAK1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50764-ACGLN
Bak/BAK1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50764-ACG
Bak/BAK1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50764-ANG
Bak/BAK1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50764-ACR
Bak/BAK1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50764-ANR
Bak/BAK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50764-CF
Bak/BAK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50764-NF
Bak/BAK1 cDNA ORF Clone, Mouse, C-His tag MG50764-CH
Bak/BAK1 cDNA ORF Clone, Mouse, C-HA tag MG50764-CY
Bak/BAK1 cDNA ORF Clone, Mouse, N-HA tag MG50764-NY
Bak/BAK1 cDNA ORF Clone, Mouse, C-Myc tag MG50764-CM
Bak/BAK1 cDNA ORF Clone, Mouse, N-Myc tag MG50764-NM
Bak/BAK1 qPCR Primer Pairs, Mouse MP200738

Bak/BAK1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Bak/BAK1 cDNA ORF Clone in Cloning Vector, Human HG10450-M
Bak/BAK1 cDNA ORF Clone, Human, untagged HG10450-UT
Bak/BAK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10450-ACG
Bak/BAK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10450-ACGLN
Bak/BAK1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10450-ANG
Bak/BAK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10450-ACR
Bak/BAK1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10450-ANR
Bak/BAK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10450-CF
Bak/BAK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10450-NF
Bak/BAK1 cDNA ORF Clone, Human, C-His tag HG10450-CH
Bak/BAK1 cDNA ORF Clone, Human, N-His tag HG10450-NH
Bak/BAK1 cDNA ORF Clone, Human, C-HA tag HG10450-CY
Bak/BAK1 cDNA ORF Clone, Human, N-HA tag HG10450-NY
Bak/BAK1 cDNA ORF Clone, Human, C-Myc tag HG10450-CM
Bak/BAK1 cDNA ORF Clone, Human, N-Myc tag HG10450-NM
Bak/BAK1 qPCR Primer Pairs, Human HP100479
info info
添加购物车成功! 添加购物车失败!