Quick Order

Mouse BAFF/BLyS/TNFSF13B Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Mouse TNFSF13B cDNA Clone Product Information
    NCBI RefSeq:NM_033622.1
    RefSeq ORF Size:930bp
    cDNA Description:Full length Clone DNA of Mus musculus tumor necrosis factor (ligand) superfamily, member 13b.
    Gene Synonym:BAFF, BLyS, TALL1, THANK, zTNF4, TALL-1, TNFSF20, MGC124060, MGC124061, D8Ertd387e, Tnfsf13b
    Species:Mouse
    Vector:pCMV3-untagged
    Plasmid:pCMV3-mTNFSF13B
    Restriction Site:KpnI + XbaI (6.1kb + 0.93kb)
    Tag Sequence:
    Sequence Description:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TNFSF13B qPCR primers for gene expression analysis, MP200373 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    B lymphocyte stimulator (BLyS), also known as TNFSF13B, CD257 and BAFF, is single-pass type II membrane protein, which belongs to the tumor necrosis factor family. BAFF is abundantly expressed in peripheral blood Leukocytes and is specifically expressed in monocytes and macrophages. BAFF is a cytokine and serves as a ligand for receptors TNFRSF13B (TACI), TNFRSF17 (BCMA), and TNFRSF13C (BAFFR). These receptors is a prominent factor in B cell differentiation, homeostasis, and selection. BLyS levels affect survival signals and selective apoptosis of autoantibody-producing B cells. Thus, it acts as a potent B cell activator and has been shown to play an important role in the proliferation and differentiation of B cells. Overexpression of BLyS in mice can lead to clinical and serological features of systemic lupus erythematosus (SLE) and Sjögren's syndrome (SS). BLyS as an attractive therapeutic target in human rheumatic diseases. The ability of BLyS to regulate both the size and repertoire of the peripheral B cell compartment raises the possibility that BLyS and antagonists thereof may form the basis of a therapeutic trichotomy. As an agonist, BLyS protein may enhance humoral immunity in congenital or acquired immunodeficiencies such as those resulting from viral infection or cancer therapy.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Nardelli B, et al. (2002) B lymphocyte stimulator (BLyS): a therapeutic trichotomy for the treatment of B lymphocyte diseases. Leuk Lymphoma. 43(7): 1367-73.
  • Stohl W. (2006) Therapeutic targeting of B lymphocyte stimulator (BLyS) in the rheumatic diseases. Endocr Metab Immune Disord Drug Targets. 6(4): 51-8.
  • Cancro MP, et al. (2009) The role of B lymphocyte stimulator (BLyS) in systemic lupus erythematosus. J Clin Invest. 119(5): 1066-73.
  • Size / Price
    Catalog: MG50352-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"