Quick Order

Mouse BAFF / TNFSF13B ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse TNFSF13B cDNA Clone Product Information
NCBI RefSeq:NM_033622.1
RefSeq ORF Size:930bp
cDNA Description:Full length Clone DNA of Mus musculus tumor necrosis factor (ligand) superfamily, member 13b with N terminal Myc tag.
Gene Synonym:BAFF, BLyS, TALL1, THANK, zTNF4, TALL-1, TNFSF20, MGC124060, MGC124061, D8Ertd387e, Tnfsf13b
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

B lymphocyte stimulator (BLyS), also known as TNFSF13B, CD257 and BAFF, is single-pass type II membrane protein, which belongs to the tumor necrosis factor family. BAFF is abundantly expressed in peripheral blood Leukocytes and is specifically expressed in monocytes and macrophages. BAFF is a cytokine and serves as a ligand for receptors TNFRSF13B (TACI), TNFRSF17 (BCMA), and TNFRSF13C (BAFFR). These receptors is a prominent factor in B cell differentiation, homeostasis, and selection. BLyS levels affect survival signals and selective apoptosis of autoantibody-producing B cells. Thus, it acts as a potent B cell activator and has been shown to play an important role in the proliferation and differentiation of B cells. Overexpression of BLyS in mice can lead to clinical and serological features of systemic lupus erythematosus (SLE) and Sjögren's syndrome (SS). BLyS as an attractive therapeutic target in human rheumatic diseases. The ability of BLyS to regulate both the size and repertoire of the peripheral B cell compartment raises the possibility that BLyS and antagonists thereof may form the basis of a therapeutic trichotomy. As an agonist, BLyS protein may enhance humoral immunity in congenital or acquired immunodeficiencies such as those resulting from viral infection or cancer therapy.

References
  • Nardelli B, et al. (2002) B lymphocyte stimulator (BLyS): a therapeutic trichotomy for the treatment of B lymphocyte diseases. Leuk Lymphoma. 43(7): 1367-73.
  • Stohl W. (2006) Therapeutic targeting of B lymphocyte stimulator (BLyS) in the rheumatic diseases. Endocr Metab Immune Disord Drug Targets. 6(4): 51-8.
  • Cancro MP, et al. (2009) The role of B lymphocyte stimulator (BLyS) in systemic lupus erythematosus. J Clin Invest. 119(5): 1066-73.
  • Size / Price
    Catalog: MG50352-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"