Quick Order

Mouse B7-H4/Vtcn1/B7S1 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse VTCN1 cDNA Clone Product Information
NCBI RefSeq:NM_178594.2
RefSeq ORF Size:852bp
cDNA Description:Full length Clone DNA of Mus musculus V-set domain containing T cell activation inhibitor 1 with N terminal HA tag.
Gene Synonym:B7x, B7S1, B7h4, B7-H4, BC032925, MGC41287
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:pCMV3-HA-mVTCN1
Restriction Site:KpnI + XbaI (6kb + 0.87kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 588 T/C, 603C/G, 705C/T, 723C/T, 762A/G, 775T/C, 780 G/C, 786T/G, 834A/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse VTCN1 Gene Plasmid Map
Mouse B7-H4 natural ORF mammalian expression plasmid, N-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

V-set domain-containing T-cell activation inhibitor 1, also known as B7X, B7H4, B7S1, and VTCN1, is a single-pass type? membrane protein belonging to the B7 family of costimulatory proteins. These proteins are expressed on the surface of antigen-presenting cells and interact with ligands on T lymphocytes. They provide costimulatory signals that regulate T cell responses. A soluble form of B7H4 has also been detected. B7X / VTCN1 / B7H4 negatively regulates T-cell-mediated immune response by inhibiting T-cell activation, proliferation, cytokine production and development of cytotoxicity. When expressed on the cell surface of tumor macrophages, B7X / VTCN1 / B7H4 plays an important role, together with regulatory T-cells(Treg), in the suppression of tumor-associated antigen-specific T-cell immunity. B7X / VTCN1 / B7H4 is also involved in promoting epithelial cell transformation. This membrane protein can be up-regulated by IL6 / interleukin-6 and IL10 / interleukin-10 and inhibited by CSF2 / GM-CSF and IL4 / interleukin-4 on antigen-presenting cells.

References
  • Zang X, et al. (2003) B7x: a widely expressed B7 family member that inhibits T cell activation. Proc Natl Acad Sci U S A. 100(18): 10388-92.
  • Suh WK, et al. (2006) Generation and characterization of B7-H4/B7S1/B7x-deficient mice. Mol Cell Biol. 26(17): 6403-11.
  • Zang X, et al. (2007) B7-H3 and B7x are highly expressed in human prostate cancer and associated with disease spread and poor outcome. Proc Natl Acad Sci U S A. 104(49):19458-63.
  • Size / Price
    Catalog: MG50017-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Mouse B7-H4 natural ORF mammalian expression plasmid, N-HA tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"