After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse CD86/B7-2 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse CD86 cDNA Clone Product Information
NCBI RefSeq:AF065897.1
RefSeq ORF Size:930bp
cDNA Description:Full length Clone DNA of Mus musculus CD86 antigen with N terminal HA tag.
Gene Synonym:B7, B70, MB7, B7-2, B7.2, CLS1, Ly58, ETC-1, Ly-58, MB7-2, Cd28l2, TS/A-2, Cd86
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:pCMV3-HA-mCD86
Restriction Site:KpnI + XbaI (6kb + 0.95kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse CD86 Gene Plasmid Map
Mouse B7-2 / CD86 natural ORF mammalian expression plasmid, N-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CD86, also known as B-lymphocyte activation antigen B7-2 (referred to as B70), is a member of the cell surface immunoglobulin superfamily. B7-2 exists predominantly as a monomer on cell surfaces and interacts with two co-stimulatory receptors CD28 and cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) expressed on T cells, and thus induces the signal pathways which regulate T cell activation and tolerance, cytokine production, and the generation of CTL. It is indicated that contacts between B and T helper cells mediated by CD86 encourage signals for the proliferation and IgG secretion of normal B cells and B cell lymphomas. Recent study has revealed that CD86 also promotes the generation of a mature APC repertoire and promotes APC function and survival. CD86 has an important role in chronic hemodialysis, allergic pulmonary inflammation, arthritis, and antiviral responses, and thus is regarded as a promising candidate for immune therapy.

References
  • Chen YQ, et al. (2006) CD28/CTLA-4--CD80/CD86 and ICOS--B7RP-1 costimulatory pathway in bronchial asthma. Allergy. 61(1): 15-26.
  • Rau FC, et al. (2009) B7-1/2 (CD80/CD86) direct signaling to B cells enhances IgG secretion. J Immunol. 183(12): 7661-71.
  • Dai ZS, et al. (2009) Defective expression and modulation of B7-2/CD86 on B cells in B cell chronic lymphocytic leukemia. Int J Hematol. 89(5): 656-63.
  • Size / Price
    Catalog: MG50068-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Mouse B7-2 / CD86 natural ORF mammalian expression plasmid, N-HA tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"