B4GALT3 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51879-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All B4GALT3 Reagents
CRO Services
Product recommended

All B4GALT3 Reagents
B4GALT3 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1188 bp
Description
Full length Clone DNA of Mouse UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

B4GALT3 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
9530061M23Rik cDNA ORF Clone, Mouse;AA104562 cDNA ORF Clone, Mouse;AW125175 cDNA ORF Clone, Mouse;ESTM26 cDNA ORF Clone, Mouse;ESTM6 cDNA ORF Clone, Mouse;R74981 cDNA ORF Clone, Mouse
B4GALT3 Background Information
Full Name
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3

B4GALT3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
B4GALT3 cDNA ORF Clone in Cloning Vector, Mouse MG51879-G
B4GALT3 cDNA ORF Clone, Mouse, untagged MG51879-UT
B4GALT3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51879-ACGLN
B4GALT3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51879-ACG
B4GALT3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51879-ACR
B4GALT3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51879-CF
B4GALT3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51879-NF
B4GALT3 cDNA ORF Clone, Mouse, C-His tag MG51879-CH
B4GALT3 cDNA ORF Clone, Mouse, N-His tag MG51879-NH
B4GALT3 cDNA ORF Clone, Mouse, N-HA tag MG51879-NY
B4GALT3 cDNA ORF Clone, Mouse, C-Myc tag MG51879-CM
B4GALT3 cDNA ORF Clone, Mouse, N-Myc tag MG51879-NM
B4GALT3 qPCR Primer Pairs, Mouse MP201752

B4GALT3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
B4GALT3 cDNA ORF Clone in Cloning Vector, Human HG16268-G
B4GALT3 cDNA ORF Clone, Human, untagged HG16268-UT
B4GALT3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16268-ACG
B4GALT3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16268-ACGLN
B4GALT3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16268-ACR
B4GALT3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16268-CF
B4GALT3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16268-NF
B4GALT3 cDNA ORF Clone, Human, C-His tag HG16268-CH
B4GALT3 cDNA ORF Clone, Human, N-His tag HG16268-NH
B4GALT3 cDNA ORF Clone, Human, C-HA tag HG16268-CY
B4GALT3 cDNA ORF Clone, Human, N-HA tag HG16268-NY
B4GALT3 cDNA ORF Clone, Human, C-Myc tag HG16268-CM
B4GALT3 cDNA ORF Clone, Human, N-Myc tag HG16268-NM
B4GALT3 qPCR Primer Pairs, Human HP105031
info info
添加购物车成功! 添加购物车失败!