Quick Order

Mouse ANGPTL4 / angiopoietin-like protein 4 Gene ORF cDNA clone expression plasmid, C-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse ANGPTL4 cDNA Clone Product Information
    NCBI RefSeq:NM_020581.2
    RefSeq ORF Size:1233bp
    cDNA Description:Full length Clone DNA of Mus musculus angiopoietin-like 4 with C terminal Myc tag.
    Gene Synonym:Arp4, Bk89, Fiaf, Ng27, Pgar, Hfarp, Pgarg, Pp1158, Angptl4
    Species:Mouse
    Vector:pCMV3-C-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ANGPTL4 qPCR primers for gene expression analysis, MP200377 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    ANGPTL4, also known as ANGPTL2, is a protein with hypoxia-induced expression in endothelial cells. It contains 1 fibrinogen C-terminal domain and is expressed at high levels in the placenta, heart, liver, muscle, pancreas and lung but expressed poorly in the brain and kidney. ANGPTL4 inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may act as a regulator of angiogenesis and modulate tumorigenesis. It inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may also exert a protective function on endothelial cells through an endocrine action. ANGPTL4 is directly involved in regulating glucose homeostasis, lipid metabolism, and insulin sensitivity. In response to hypoxia, the unprocessed form of the protein accumulates in the subendothelial extracellular matrix (ECM). The matrix-associated and immobilized unprocessed form limits the formation of actin stress fibers and focal contacts in the adhering endothelial cells and inhibits their adhesion. It also decreases motility of endothelial cells and inhibits the sprouting and tube formation.

    References
  • Lichtenstein L, et al. (2010) Angptl4 Protects against Severe Proinflammatory Effects of Saturated Fat by Inhibiting Fatty Acid Uptake into Mesenteric Lymph Node Macrophages. Cell metabolism. 12(6): 580-92.
  • Terada S, et al. (2011) Escaping Anoikis through ROS: ANGPTL4 controls integrin signaling through Nox1. Cancer Cell. 19(3):297-9.
  • Zhu PC, et al. (2011) Angptl4 protein elevates the prosurvival intracellular O2(-):H2O2 ratio and confers anoikis resistance to tumors. Cancer Cell. 19(3):401-15.
  • Size / Price
    Catalog: MG50356-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"