ANGPTL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG50434-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ANGPTL1 Reagents
CRO Services
Product recommended

All ANGPTL1 Reagents
ANGPTL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1473 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 324C/T, 1140A/G, 1374T/C not causing the amino acid variation.
Description
Full length Clone DNA of Mouse angiopoietin-like 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
Nhe + XbaI (6kb + 1.51kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ANGPTL1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ANGPTL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images
Mouse ANGPTL1/ANG-3 Gene Expression validated Image 2168
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Mouse ANGPTL1/ANG-3 Gene Plasmid Map 5890
ANGPTL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
2810039D03Rik cDNA ORF Clone, Mouse;ANG3 cDNA ORF Clone, Mouse;ANGPT3 cDNA ORF Clone, Mouse;ANGY cDNA ORF Clone, Mouse;ARP1 cDNA ORF Clone, Mouse
ANGPTL1 Background Information
Full Name
angiopoietin-like 1

ANGPTL1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
ANGPTL1 cDNA ORF Clone in Cloning Vector, Canine DG70032-G
ANGPTL1 cDNA ORF Clone, Canine, untagged DG70032-UT
ANGPTL1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70032-ACGLN
ANGPTL1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70032-ACG
ANGPTL1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70032-ACR
ANGPTL1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70032-CF
ANGPTL1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70032-NF
ANGPTL1 cDNA ORF Clone, Canine, C-His tag DG70032-CH
ANGPTL1 cDNA ORF Clone, Canine, N-His tag DG70032-NH
ANGPTL1 cDNA ORF Clone, Canine, C-HA tag DG70032-CY
ANGPTL1 cDNA ORF Clone, Canine, N-HA tag DG70032-NY
ANGPTL1 cDNA ORF Clone, Canine, C-Myc tag DG70032-CM
ANGPTL1 cDNA ORF Clone, Canine, N-Myc tag DG70032-NM

ANGPTL1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ANGPTL1 cDNA ORF Clone in Cloning Vector, Mouse MG50434-M
ANGPTL1 cDNA ORF Clone, Mouse, untagged MG50434-UT
ANGPTL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50434-ACGLN
ANGPTL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50434-ACG
ANGPTL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50434-ACR
ANGPTL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50434-NF
ANGPTL1 cDNA ORF Clone, Mouse, C-His tag MG50434-CH
ANGPTL1 cDNA ORF Clone, Mouse, N-His tag MG50434-NH
ANGPTL1 cDNA ORF Clone, Mouse, C-HA tag MG50434-CY
ANGPTL1 cDNA ORF Clone, Mouse, N-HA tag MG50434-NY
ANGPTL1 cDNA ORF Clone, Mouse, C-Myc tag MG50434-CM
ANGPTL1 cDNA ORF Clone, Mouse, N-Myc tag MG50434-NM
ANGPTL1 qPCR Primer Pairs, Mouse MP200443

ANGPTL1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ANGPTL1 cDNA ORF Clone in Cloning Vector, Human HG10776-M
ANGPTL1 cDNA ORF Clone, Human, untagged HG10776-UT
ANGPTL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10776-ACGLN
ANGPTL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10776-ACG
ANGPTL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10776-ACR
ANGPTL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10776-CF
ANGPTL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10776-NF
ANGPTL1 cDNA ORF Clone, Human, C-His tag HG10776-CH
ANGPTL1 cDNA ORF Clone, Human, N-His tag HG10776-NH
ANGPTL1 cDNA ORF Clone, Human, C-HA tag HG10776-CY
ANGPTL1 cDNA ORF Clone, Human, N-HA tag HG10776-NY
ANGPTL1 cDNA ORF Clone, Human, C-Myc tag HG10776-CM
ANGPTL1 cDNA ORF Clone, Human, N-Myc tag HG10776-NM
ANGPTL1 qPCR Primer Pairs, Human HP100696
info info
添加购物车成功! 添加购物车失败!