AVPI1 cDNA ORF Clone, Mouse, untagged

Cat: MG51489-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AVPI1 Reagents
CRO Services
Product recommended

All AVPI1 Reagents
AVPI1 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
429 bp
Description
Full length Clone DNA of Mouse arginine vasopressin-induced 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AVPI1 cDNA ORF Clone, Mouse, untagged Alternative Names
2310008N12Rik cDNA ORF Clone, Mouse;AA410041 cDNA ORF Clone, Mouse;esu cDNA ORF Clone, Mouse;mVIT32 cDNA ORF Clone, Mouse;VIT32 cDNA ORF Clone, Mouse
AVPI1 Background Information
Full Name
arginine vasopressin-induced 1

AVPI1 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
AVPI1 cDNA ORF Clone in Cloning Vector, Rabbit TG65091-G
AVPI1 cDNA ORF Clone, Rabbit, untagged TG65091-UT
AVPI1 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65091-ACG
AVPI1 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65091-ANG
AVPI1 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65091-ACR
AVPI1 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65091-ANR
AVPI1 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65091-CF
AVPI1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65091-NF
AVPI1 cDNA ORF Clone, Rabbit, C-His tag TG65091-CH
AVPI1 cDNA ORF Clone, Rabbit, N-His tag TG65091-NH
AVPI1 cDNA ORF Clone, Rabbit, C-HA tag TG65091-CY
AVPI1 cDNA ORF Clone, Rabbit, N-HA tag TG65091-NY
AVPI1 cDNA ORF Clone, Rabbit, C-Myc tag TG65091-CM
AVPI1 cDNA ORF Clone, Rabbit, N-Myc tag TG65091-NM

AVPI1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AVPI1 cDNA ORF Clone in Cloning Vector, Mouse MG51489-G
AVPI1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51489-ACGLN
AVPI1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51489-ACG
AVPI1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51489-ANG
AVPI1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51489-ACR
AVPI1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51489-ANR
AVPI1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51489-CF
AVPI1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51489-NF
AVPI1 cDNA ORF Clone, Mouse, C-His tag MG51489-CH
AVPI1 cDNA ORF Clone, Mouse, N-His tag MG51489-NH
AVPI1 cDNA ORF Clone, Mouse, C-HA tag MG51489-CY
AVPI1 cDNA ORF Clone, Mouse, N-HA tag MG51489-NY
AVPI1 cDNA ORF Clone, Mouse, C-Myc tag MG51489-CM
AVPI1 cDNA ORF Clone, Mouse, N-Myc tag MG51489-NM
AVPI1 qPCR Primer Pairs, Mouse MP201373

AVPI1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AVPI1 cDNA ORF Clone in Cloning Vector, Human HG25877-U
AVPI1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG25877-ACGLN
info info
添加购物车成功! 添加购物车失败!