ATXN7L3B cDNA ORF Clone, Mouse, untagged

Cat: MG51483-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ATXN7L3B Reagents
CRO Services
Product recommended

All ATXN7L3B Reagents
ATXN7L3B cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
294 bp
Description
Full length Clone DNA of Mouse ataxin 7-like 3B.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATXN7L3B cDNA ORF Clone, Mouse, untagged Alternative Names
4921506J03Rik cDNA ORF Clone, Mouse;6230409E21Rik cDNA ORF Clone, Mouse;AI315132 cDNA ORF Clone, Mouse;ENSMUSG00000074747 cDNA ORF Clone, Mouse
ATXN7L3B Background Information
Full Name
ataxin 7-like 3B

ATXN7L3B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ATXN7L3B cDNA ORF Clone in Cloning Vector, Rat RG89448-U
ATXN7L3B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG89448-ACGLN

ATXN7L3B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATXN7L3B cDNA ORF Clone in Cloning Vector, Mouse MG51483-U
ATXN7L3B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51483-ACGLN
ATXN7L3B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51483-ACG
ATXN7L3B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51483-ANG
ATXN7L3B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51483-ACR
ATXN7L3B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51483-ANR
ATXN7L3B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51483-CF
ATXN7L3B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51483-NF
ATXN7L3B cDNA ORF Clone, Mouse, C-His tag MG51483-CH
ATXN7L3B cDNA ORF Clone, Mouse, N-His tag MG51483-NH
ATXN7L3B cDNA ORF Clone, Mouse, C-HA tag MG51483-CY
ATXN7L3B cDNA ORF Clone, Mouse, N-HA tag MG51483-NY
ATXN7L3B cDNA ORF Clone, Mouse, C-Myc tag MG51483-CM
ATXN7L3B cDNA ORF Clone, Mouse, N-Myc tag MG51483-NM
ATXN7L3B qPCR Primer Pairs, Mouse MP201367

ATXN7L3B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATXN7L3B cDNA ORF Clone in Cloning Vector, Human HG26784-U
ATXN7L3B cDNA ORF Clone, Human, untagged HG26784-UT
ATXN7L3B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG26784-ACGLN
ATXN7L3B cDNA ORF Clone, Human, C-GFPSpark® tag HG26784-ACG
ATXN7L3B cDNA ORF Clone, Human, N-GFPSpark® tag HG26784-ANG
ATXN7L3B cDNA ORF Clone, Human, C-OFPSpark® tag HG26784-ACR
ATXN7L3B cDNA ORF Clone, Human, N-OFPSpark® tag HG26784-ANR
ATXN7L3B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG26784-CF
ATXN7L3B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG26784-NF
ATXN7L3B cDNA ORF Clone, Human, C-His tag HG26784-CH
ATXN7L3B cDNA ORF Clone, Human, N-His tag HG26784-NH
ATXN7L3B cDNA ORF Clone, Human, C-HA tag HG26784-CY
ATXN7L3B cDNA ORF Clone, Human, N-HA tag HG26784-NY
ATXN7L3B cDNA ORF Clone, Human, C-Myc tag HG26784-CM
ATXN7L3B cDNA ORF Clone, Human, N-Myc tag HG26784-NM
info info
添加购物车成功! 添加购物车失败!