ATP6V0C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51745-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ATP6V0C Reagents
CRO Services
Product recommended

All ATP6V0C Reagents
ATP6V0C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
468 bp
Description
Full length Clone DNA of Mouse ATPase, H+ transporting, lysosomal V0 subunit C with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATP6V0C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
Atp6c cDNA ORF Clone, Mouse;Atp6c2 cDNA ORF Clone, Mouse;Atp6l cDNA ORF Clone, Mouse;Atpl cDNA ORF Clone, Mouse;Atpl-rs1 cDNA ORF Clone, Mouse;PL16 cDNA ORF Clone, Mouse;VATL cDNA ORF Clone, Mouse;Vma3 cDNA ORF Clone, Mouse
ATP6V0C Background Information
Full Name
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c

ATP6V0C cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ATP6V0C cDNA ORF Clone in Cloning Vector, Rat RG81211-U
ATP6V0C cDNA ORF Clone, Rat, untagged RG81211-UT
ATP6V0C cDNA ORF Clone, Rat, C-GFPSpark® tag RG81211-ACG
ATP6V0C Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81211-ACGLN
ATP6V0C cDNA ORF Clone, Rat, C-OFPSpark® tag RG81211-ACR
ATP6V0C cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81211-CF
ATP6V0C cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81211-NF
ATP6V0C cDNA ORF Clone, Rat, C-His tag RG81211-CH
ATP6V0C cDNA ORF Clone, Rat, N-His tag RG81211-NH
ATP6V0C cDNA ORF Clone, Rat, C-HA tag RG81211-CY
ATP6V0C cDNA ORF Clone, Rat, N-HA tag RG81211-NY
ATP6V0C cDNA ORF Clone, Rat, C-Myc tag RG81211-CM
ATP6V0C cDNA ORF Clone, Rat, N-Myc tag RG81211-NM
ATP6V0C qPCR Primer Pairs, Rat RP301167

ATP6V0C cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATP6V0C cDNA ORF Clone in Cloning Vector, Mouse MG51745-G
ATP6V0C cDNA ORF Clone, Mouse, untagged MG51745-UT
ATP6V0C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51745-ACGLN
ATP6V0C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51745-ACG
ATP6V0C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51745-ACR
ATP6V0C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51745-NF
ATP6V0C cDNA ORF Clone, Mouse, C-His tag MG51745-CH
ATP6V0C cDNA ORF Clone, Mouse, N-His tag MG51745-NH
ATP6V0C cDNA ORF Clone, Mouse, C-HA tag MG51745-CY
ATP6V0C cDNA ORF Clone, Mouse, N-HA tag MG51745-NY
ATP6V0C cDNA ORF Clone, Mouse, C-Myc tag MG51745-CM
ATP6V0C cDNA ORF Clone, Mouse, N-Myc tag MG51745-NM
ATP6V0C qPCR Primer Pairs, Mouse MP201618

ATP6V0C cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATP6V0C cDNA ORF Clone in Cloning Vector, Human HG17204-U
ATP6V0C cDNA ORF Clone, Human, untagged HG17204-UT
ATP6V0C cDNA ORF Clone, Human, C-GFPSpark® tag HG17204-ACG
ATP6V0C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17204-ACGLN
ATP6V0C cDNA ORF Clone, Human, C-OFPSpark® tag HG17204-ACR
ATP6V0C cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17204-CF
ATP6V0C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17204-NF
ATP6V0C cDNA ORF Clone, Human, C-His tag HG17204-CH
ATP6V0C cDNA ORF Clone, Human, N-His tag HG17204-NH
ATP6V0C cDNA ORF Clone, Human, C-HA tag HG17204-CY
ATP6V0C cDNA ORF Clone, Human, N-HA tag HG17204-NY
ATP6V0C cDNA ORF Clone, Human, C-Myc tag HG17204-CM
ATP6V0C cDNA ORF Clone, Human, N-Myc tag HG17204-NM
info info
添加购物车成功! 添加购物车失败!