ATP5G1 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51226-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ATP5G1 Reagents
CRO Services
Product recommended

All ATP5G1 Reagents
ATP5G1 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
411 bp
Description
Full length Clone DNA of Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c1 (subunit 9) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATP5G1 Background Information
Full Name
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9)

ATP5G1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ATP5G1 cDNA ORF Clone in Cloning Vector, Rat RG84208-U
ATP5G1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84208-ACGLN

ATP5G1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATP5G1 cDNA ORF Clone in Cloning Vector, Mouse MG51226-U
ATP5G1 cDNA ORF Clone, Mouse, untagged MG51226-UT
ATP5G1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51226-ACG
ATP5G1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51226-ACGLN
ATP5G1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51226-ANG
ATP5G1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51226-ACR
ATP5G1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51226-ANR
ATP5G1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51226-CF
ATP5G1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51226-NF
ATP5G1 cDNA ORF Clone, Mouse, C-His tag MG51226-CH
ATP5G1 cDNA ORF Clone, Mouse, N-His tag MG51226-NH
ATP5G1 cDNA ORF Clone, Mouse, N-HA tag MG51226-NY
ATP5G1 cDNA ORF Clone, Mouse, C-Myc tag MG51226-CM
ATP5G1 cDNA ORF Clone, Mouse, N-Myc tag MG51226-NM
ATP5G1 qPCR Primer Pairs, Mouse MP201109

ATP5G1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATP5G1 cDNA ORF Clone in Cloning Vector, Human HG16732-U
ATP5G1 cDNA ORF Clone, Human, untagged HG16732-UT
ATP5G1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16732-ACGLN
ATP5G1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16732-ACG
ATP5G1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16732-ANG
ATP5G1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16732-ACR
ATP5G1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16732-ANR
ATP5G1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16732-CF
ATP5G1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16732-NF
ATP5G1 cDNA ORF Clone, Human, C-His tag HG16732-CH
ATP5G1 cDNA ORF Clone, Human, N-His tag HG16732-NH
ATP5G1 cDNA ORF Clone, Human, C-HA tag HG16732-CY
ATP5G1 cDNA ORF Clone, Human, N-HA tag HG16732-NY
ATP5G1 cDNA ORF Clone, Human, C-Myc tag HG16732-CM
ATP5G1 cDNA ORF Clone, Human, N-Myc tag HG16732-NM
info info
添加购物车成功! 添加购物车失败!