ATP5D cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52204-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ATP5D Reagents
CRO Services
Product recommended

All ATP5D Reagents
ATP5D cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
507 bp
Description
Full length Clone DNA of Mouse ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATP5D cDNA ORF Clone, Mouse, N-HA tag Alternative Names
0610008F14Rik cDNA ORF Clone, Mouse;1500000I11Rik cDNA ORF Clone, Mouse;AA960090 cDNA ORF Clone, Mouse;AI876556 cDNA ORF Clone, Mouse;AU020773 cDNA ORF Clone, Mouse;C85518 cDNA ORF Clone, Mouse
ATP5D Background Information

ATP5D is a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase consists of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). ATP5D gene encodes the delta subunit of the catalytic core.

Full Name
ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
References
  • Jordan EM. et al., 1992, Biochim Biophys Acta 1130 (1): 123-6.
  • Yoshida M. et al., 2001, Nat Rev Mol Cell Biol. 2 (9): 669-77.
  • Hochstrasser DF. et al., 1993, Electrophoresis. 13 (12): 992-1001.
  • ATP5D cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ATP5D cDNA ORF Clone in Cloning Vector, Mouse MG52204-G
    ATP5D cDNA ORF Clone, Mouse, untagged MG52204-UT
    ATP5D Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52204-ACGLN
    ATP5D cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52204-ACG
    ATP5D cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52204-ANG
    ATP5D cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52204-ACR
    ATP5D cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52204-ANR
    ATP5D cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52204-CF
    ATP5D cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52204-NF
    ATP5D cDNA ORF Clone, Mouse, C-His tag MG52204-CH
    ATP5D cDNA ORF Clone, Mouse, N-His tag MG52204-NH
    ATP5D cDNA ORF Clone, Mouse, C-HA tag MG52204-CY
    ATP5D cDNA ORF Clone, Mouse, C-Myc tag MG52204-CM
    ATP5D cDNA ORF Clone, Mouse, N-Myc tag MG52204-NM
    ATP5D qPCR Primer Pairs, Mouse MP202077

    ATP5D cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ATP5D cDNA ORF Clone in Cloning Vector, Human HG14630-G
    ATP5D cDNA ORF Clone, Human, untagged HG14630-UT
    ATP5D cDNA ORF Clone, Human, C-GFPSpark® tag HG14630-ACG
    ATP5D Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14630-ACGLN
    ATP5D cDNA ORF Clone, Human, N-GFPSpark® tag HG14630-ANG
    ATP5D cDNA ORF Clone, Human, C-OFPSpark® tag HG14630-ACR
    ATP5D cDNA ORF Clone, Human, N-OFPSpark® tag HG14630-ANR
    ATP5D cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14630-CF
    ATP5D cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14630-NF
    ATP5D cDNA ORF Clone, Human, C-His tag HG14630-CH
    ATP5D cDNA ORF Clone, Human, N-His tag HG14630-NH
    ATP5D cDNA ORF Clone, Human, C-HA tag HG14630-CY
    ATP5D cDNA ORF Clone, Human, N-HA tag HG14630-NY
    ATP5D cDNA ORF Clone, Human, C-Myc tag HG14630-CM
    ATP5D cDNA ORF Clone, Human, N-Myc tag HG14630-NM
    ATP5D qPCR Primer Pairs, Human HP103264
    info info
    添加购物车成功! 添加购物车失败!