ATG5/APG5L cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51552-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ATG5/APG5L Reagents
CRO Services
Product recommended

All ATG5/APG5L Reagents
ATG5/APG5L cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
828 bp
Description
Full length Clone DNA of Mouse autophagy related 5 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATG5/APG5L cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
2010107M05Rik cDNA ORF Clone, Mouse;3110067M24Rik cDNA ORF Clone, Mouse;Apg5l cDNA ORF Clone, Mouse;Atg5l cDNA ORF Clone, Mouse;AW319544 cDNA ORF Clone, Mouse;C88337 cDNA ORF Clone, Mouse;Paddy cDNA ORF Clone, Mouse
ATG5/APG5L Background Information
Full Name
autophagy related 5

ATG5/APG5L cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATG5/APG5L cDNA ORF Clone in Cloning Vector, Mouse MG51552-G
ATG5/APG5L cDNA ORF Clone, Mouse, untagged MG51552-UT
ATG5/APG5L Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51552-ACGLN
ATG5/APG5L cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51552-ACG
ATG5/APG5L cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51552-ANG
ATG5/APG5L cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51552-ACR
ATG5/APG5L cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51552-ANR
ATG5/APG5L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51552-CF
ATG5/APG5L cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51552-NF
ATG5/APG5L cDNA ORF Clone, Mouse, C-His tag MG51552-CH
ATG5/APG5L cDNA ORF Clone, Mouse, N-His tag MG51552-NH
ATG5/APG5L cDNA ORF Clone, Mouse, C-HA tag MG51552-CY
ATG5/APG5L cDNA ORF Clone, Mouse, N-HA tag MG51552-NY
ATG5/APG5L cDNA ORF Clone, Mouse, C-Myc tag MG51552-CM
ATG5/APG5L qPCR Primer Pairs, Mouse MP201436

ATG5/APG5L cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATG5/APG5L cDNA ORF Clone in Cloning Vector, Human HG15063-G
ATG5/APG5L cDNA ORF Clone, Human, untagged HG15063-UT
ATG5/APG5L Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15063-ACGLN
ATG5/APG5L cDNA ORF Clone, Human, C-GFPSpark® tag HG15063-ACG
ATG5/APG5L cDNA ORF Clone, Human, N-GFPSpark® tag HG15063-ANG
ATG5/APG5L cDNA ORF Clone, Human, C-OFPSpark® tag HG15063-ACR
ATG5/APG5L cDNA ORF Clone, Human, N-OFPSpark® tag HG15063-ANR
ATG5/APG5L cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15063-CF
ATG5/APG5L cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15063-NF
ATG5/APG5L cDNA ORF Clone, Human, C-His tag HG15063-CH
ATG5/APG5L cDNA ORF Clone, Human, N-His tag HG15063-NH
ATG5/APG5L cDNA ORF Clone, Human, C-HA tag HG15063-CY
ATG5/APG5L cDNA ORF Clone, Human, N-HA tag HG15063-NY
ATG5/APG5L cDNA ORF Clone, Human, C-Myc tag HG15063-CM
ATG5/APG5L cDNA ORF Clone, Human, N-Myc tag HG15063-NM
ATG5/APG5L qPCR Primer Pairs, Human HP103691
info info
添加购物车成功! 添加购物车失败!