ATF-4 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52828-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ATF-4 Reagents
CRO Services
Product recommended

All ATF-4 Reagents
ATF-4 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1050 bp
Description
Full length Clone DNA of Mouse activating transcription factor 4 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATF-4 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
Atf-4 cDNA ORF Clone, Mouse;C/ATF cDNA ORF Clone, Mouse;CREB2 cDNA ORF Clone, Mouse;TAXREB67 cDNA ORF Clone, Mouse
ATF-4 Background Information
Full Name
activating transcription factor 4

ATF-4 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
ATF-4 cDNA ORF Clone in Cloning Vector, Ferret FG60104-G
ATF-4 cDNA ORF Clone, Ferret, untagged FG60104-UT
ATF-4 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60104-ACGLN
ATF-4 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60104-ACG
ATF-4 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60104-ANG
ATF-4 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60104-ACR
ATF-4 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60104-ANR
ATF-4 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60104-CF
ATF-4 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60104-NF
ATF-4 cDNA ORF Clone, Ferret, C-His tag FG60104-CH
ATF-4 cDNA ORF Clone, Ferret, N-His tag FG60104-NH
ATF-4 cDNA ORF Clone, Ferret, C-HA tag FG60104-CY
ATF-4 cDNA ORF Clone, Ferret, N-HA tag FG60104-NY
ATF-4 cDNA ORF Clone, Ferret, C-Myc tag FG60104-CM
ATF-4 cDNA ORF Clone, Ferret, N-Myc tag FG60104-NM

ATF-4 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
ATF-4 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90357-G
ATF-4 cDNA ORF Clone, Cynomolgus, untagged CG90357-UT
ATF-4 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90357-ACGLN
ATF-4 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90357-ACG
ATF-4 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90357-ANG
ATF-4 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90357-ACR
ATF-4 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90357-ANR
ATF-4 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90357-CF
ATF-4 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90357-NF
ATF-4 cDNA ORF Clone, Cynomolgus, C-His tag CG90357-CH
ATF-4 cDNA ORF Clone, Cynomolgus, N-His tag CG90357-NH
ATF-4 cDNA ORF Clone, Cynomolgus, C-HA tag CG90357-CY
ATF-4 cDNA ORF Clone, Cynomolgus, N-HA tag CG90357-NY
ATF-4 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90357-CM
ATF-4 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90357-NM

ATF-4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ATF-4 cDNA ORF Clone in Cloning Vector, Rat RG82984-U
ATF-4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82984-ACGLN

ATF-4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATF-4 cDNA ORF Clone in Cloning Vector, Mouse MG52828-G
ATF-4 cDNA ORF Clone, Mouse, untagged MG52828-UT
ATF-4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52828-ACG
ATF-4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52828-ACGLN
ATF-4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52828-ANG
ATF-4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52828-ACR
ATF-4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52828-ANR
ATF-4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52828-CF
ATF-4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52828-NF
ATF-4 cDNA ORF Clone, Mouse, C-His tag MG52828-CH
ATF-4 cDNA ORF Clone, Mouse, N-His tag MG52828-NH
ATF-4 cDNA ORF Clone, Mouse, C-HA tag MG52828-CY
ATF-4 cDNA ORF Clone, Mouse, C-Myc tag MG52828-CM
ATF-4 cDNA ORF Clone, Mouse, N-Myc tag MG52828-NM

ATF-4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATF-4 cDNA ORF Clone in Cloning Vector, Human HG11124-M
ATF-4 cDNA ORF Clone, Human, untagged HG11124-UT
ATF-4 cDNA ORF Clone, Human, C-GFPSpark® tag HG11124-ACG
ATF-4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11124-ACGLN
ATF-4 cDNA ORF Clone, Human, N-GFPSpark® tag HG11124-ANG
ATF-4 cDNA ORF Clone, Human, C-OFPSpark® tag HG11124-ACR
ATF-4 cDNA ORF Clone, Human, N-OFPSpark® tag HG11124-ANR
ATF-4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11124-CF
ATF-4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11124-NF
ATF-4 cDNA ORF Clone, Human, C-His tag HG11124-CH
ATF-4 cDNA ORF Clone, Human, N-His tag HG11124-NH
ATF-4 cDNA ORF Clone, Human, C-HA tag HG11124-CY
ATF-4 cDNA ORF Clone, Human, N-HA tag HG11124-NY
ATF-4 cDNA ORF Clone, Human, C-Myc tag HG11124-CM
ATF-4 cDNA ORF Clone, Human, N-Myc tag HG11124-NM
ATF-4 qPCR Primer Pairs, Human HP101036
info info
添加购物车成功! 添加购物车失败!