Text Size:AAA

Mouse ATF2 Gene ORF cDNA clone expression plasmid, N-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse ATF2 cDNA Clone Product Information
    NCBI RefSeq:NM_001025093.1
    RefSeq ORF Size:1464bp
    cDNA Description:Full length Clone DNA of Mus musculus activating transcription factor 2, isfrom 1 with N terminal HA tag.
    Gene Synonym:mXBP, Atf-2, Creb2, CRE-BP, D18875, MGC105211, MGC105222, D130078H02Rik, Tg(Gzma-Klra1)7Wum, Atf2
    Species:Mouse
    Vector:pCMV3-N-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ATF2 qPCR primers for gene expression analysis, MP200287 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    Activating transcription factor 2, also known as ATF2, is a member of the leucine zipper family of DNA-binding proteins that binds to the cAMP response element. Its activity is enhanced after phosphorylation by stress-activated protein kinases such as c-Jun N-terminal kinase and p38. ATF2 has been found to be a target of the JNK signal transduction pathway and mediate adenovirus E1A-inducible transcriptional activation. ATF2 is also been reported playing roles in TGF-β signaling pathway. It has been shown that the transcription factor ATF2 is bound by a hetero-oligomer of Smad3 and Smad4 upon TGF-β stimulation. Studies indicate that ATF-2 plays a central role in TGF-β signaling by acting as a common nuclear target of both Smad and TAK1 pathways. 

    References
  • Livingstone C, et al. (1995) ATF-2 contains a phosphorylation-dependent transcriptional activation domain. EMBO J. 14 (8): 1785-97.
  • Gupta S, et al. (1995) Transcription factor ATF2 regulation by the JNK signal transduction pathway. Science . 267 (5196): 389-93.
  • Sano YJ, et al. (1999) ATF-2 Is a Common Nuclear Target of Smad and TAK1 Pathways in Transforming Growth Factor-_ Signaling. The Journal of Biological Chemistry. 274: 8949-57.
  • Size / Price
    Catalog: MG50262-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"