ATAD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51787-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ATAD1 Reagents
CRO Services
Product recommended

All ATAD1 Reagents
ATAD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1086 bp
Description
Full length Clone DNA of Mouse ATPase family, AAA domain containing 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATAD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
4921525H23Rik cDNA ORF Clone, Mouse;AW107648 cDNA ORF Clone, Mouse;Thorase cDNA ORF Clone, Mouse
ATAD1 Background Information
Full Name
ATPase family, AAA domain containing 1

ATAD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATAD1 cDNA ORF Clone in Cloning Vector, Mouse MG51787-G
ATAD1 cDNA ORF Clone, Mouse, untagged MG51787-UT
ATAD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51787-ACGLN
ATAD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51787-ACG
ATAD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51787-ANG
ATAD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51787-ACR
ATAD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51787-ANR
ATAD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51787-NF
ATAD1 cDNA ORF Clone, Mouse, C-His tag MG51787-CH
ATAD1 cDNA ORF Clone, Mouse, N-His tag MG51787-NH
ATAD1 cDNA ORF Clone, Mouse, C-HA tag MG51787-CY
ATAD1 cDNA ORF Clone, Mouse, N-HA tag MG51787-NY
ATAD1 cDNA ORF Clone, Mouse, C-Myc tag MG51787-CM
ATAD1 cDNA ORF Clone, Mouse, N-Myc tag MG51787-NM
ATAD1 qPCR Primer Pairs, Mouse MP201660

ATAD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATAD1 cDNA ORF Clone in Cloning Vector, Human HG15517-G
ATAD1 cDNA ORF Clone, Human, untagged HG15517-UT
ATAD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15517-ACGLN
ATAD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15517-ACG
ATAD1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15517-ANG
ATAD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15517-ACR
ATAD1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15517-ANR
ATAD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15517-CF
ATAD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15517-NF
ATAD1 cDNA ORF Clone, Human, C-His tag HG15517-CH
ATAD1 cDNA ORF Clone, Human, N-His tag HG15517-NH
ATAD1 cDNA ORF Clone, Human, C-HA tag HG15517-CY
ATAD1 cDNA ORF Clone, Human, N-HA tag HG15517-NY
ATAD1 cDNA ORF Clone, Human, C-Myc tag HG15517-CM
ATAD1 cDNA ORF Clone, Human, N-Myc tag HG15517-NM
ATAD1 qPCR Primer Pairs, Human HP104139
info info
添加购物车成功! 添加购物车失败!