ASL cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52668-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ASL Reagents
CRO Services
Product recommended

All ASL Reagents
ASL cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1395 bp
Description
Full length Clone DNA of Mouse argininosuccinate lyase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ASL cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
2510006M18Rik cDNA ORF Clone, Mouse
ASL Background Information
Full Name
argininosuccinate lyase

ASL cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ASL cDNA ORF Clone in Cloning Vector, Rat RG82293-U
ASL Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82293-ACGLN

ASL cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ASL cDNA ORF Clone in Cloning Vector, Mouse MG52668-G
ASL cDNA ORF Clone, Mouse, untagged MG52668-UT
ASL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52668-ACG
ASL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52668-ACGLN
ASL cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52668-ANG
ASL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52668-ACR
ASL cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52668-ANR
ASL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52668-CF
ASL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52668-NF
ASL cDNA ORF Clone, Mouse, C-His tag MG52668-CH
ASL cDNA ORF Clone, Mouse, N-His tag MG52668-NH
ASL cDNA ORF Clone, Mouse, C-HA tag MG52668-CY
ASL cDNA ORF Clone, Mouse, N-HA tag MG52668-NY
ASL cDNA ORF Clone, Mouse, C-Myc tag MG52668-CM
ASL qPCR Primer Pairs, Mouse MP202539

ASL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ASL cDNA ORF Clone in Cloning Vector, Human HG14080-G
ASL cDNA ORF Clone, Human, untagged HG14080-UT
ASL cDNA ORF Clone, Human, C-GFPSpark® tag HG14080-ACG
ASL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14080-ACGLN
ASL cDNA ORF Clone, Human, N-GFPSpark® tag HG14080-ANG
ASL cDNA ORF Clone, Human, C-OFPSpark® tag HG14080-ACR
ASL cDNA ORF Clone, Human, N-OFPSpark® tag HG14080-ANR
ASL cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14080-CF
ASL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14080-NF
ASL cDNA ORF Clone, Human, C-His tag HG14080-CH
ASL cDNA ORF Clone, Human, N-His tag HG14080-NH
ASL cDNA ORF Clone, Human, C-HA tag HG14080-CY
ASL cDNA ORF Clone, Human, N-HA tag HG14080-NY
ASL cDNA ORF Clone, Human, C-Myc tag HG14080-CM
ASL cDNA ORF Clone, Human, N-Myc tag HG14080-NM
ASL qPCR Primer Pairs, Human HP102734
info info
添加购物车成功! 添加购物车失败!