Asialoglycoprotein Receptor 1 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50083-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Asialoglycoprotein Receptor 1 Reagents
CRO Services
Product recommended

All Asialoglycoprotein Receptor 1 Reagents
Asialoglycoprotein Receptor 1 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
855 bp
Description
Full length Clone DNA of Mouse asialoglycoprotein receptor 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Asialoglycoprotein Receptor 1 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
ASGPR1 cDNA ORF Clone, Mouse;Asgr cDNA ORF Clone, Mouse;Asgr-1 cDNA ORF Clone, Mouse;HL-1 cDNA ORF Clone, Mouse
Asialoglycoprotein Receptor 1 Background Information

The asialoglycoprotein receptor (ASGPR), an endocytotic cell surface receptor expressed by hepatocytes, is triggered by triantennary binding to galactose residues of macromolecules such as asialoorosomucoid (ASOR). ASGPR belongs to the long-form subfamily of the C-type/Ca2+ dependent lectin family. It is a complex of two noncovalently-linked and highly homologous subunits, a major 42 kDa glycoprotein ASGPR1(MHL-1) and a minor 51 kDa glycoprotein ASGR2 (MHL-2). ASGPR1 is synthesized as a type II transmembrane protein that contains a cytosolic N-terminal domain, a single transmembrane segment, and an extracellular domain which contains two important structural regions. The first is a stalk domain that contributes to noncovalent oligomerization, and the second is a Ca2+-dependent carbohydrate binding domain at the very C-terminus that is unusually stabilized by three ions. The research regarded that ASGPR1 could be targeted for anti- hepatitis B virus (HBV) drug development.

Full Name
asialoglycoprotein receptor 1
References
  • Yang J, et al. (2006) Antisense oligonucleotides targeted against asialoglycoprotein receptor 1 block human hepatitis B virus replication. J Viral Hepat. 13(3): 158-65.
  • Li Y, et al. (2008) Targeted delivery of macromolecular drugs: asialoglycoprotein receptor (ASGPR) expression by selected hepatoma cell lines used in antiviral drug development. Curr Drug Deliv. 5(4): 299-302.
  • Asialoglycoprotein Receptor 1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Rat, untagged RG83708-UT
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG83708-ACG
    Asialoglycoprotein Receptor 1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83708-ACGLN
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG83708-ACR
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG83708-CF
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG83708-NF
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Rat, C-His tag RG83708-CH
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Rat, N-His tag RG83708-NH
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Rat, C-HA tag RG83708-CY
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Rat, N-HA tag RG83708-NY
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Rat, C-Myc tag RG83708-CM
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Rat, N-Myc tag RG83708-NM

    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Asialoglycoprotein Receptor 1 cDNA ORF Clone in Cloning Vector, Mouse MG50083-M
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Mouse, untagged MG50083-UT
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50083-ACG
    Asialoglycoprotein Receptor 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50083-ACGLN
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50083-ACR
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50083-CF
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50083-NF
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Mouse, C-His tag MG50083-CH
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Mouse, N-His tag MG50083-NH
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Mouse, C-HA tag MG50083-CY
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Mouse, C-Myc tag MG50083-CM
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Mouse, N-Myc tag MG50083-NM
    Asialoglycoprotein Receptor 1 qPCR Primer Pairs, Mouse MP200113

    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Asialoglycoprotein Receptor 1 cDNA ORF Clone in Cloning Vector, Human HG10773-M
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Human, untagged HG10773-UT
    Asialoglycoprotein Receptor 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10773-ACGLN
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10773-ACG
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10773-ACR
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10773-CF
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10773-NF
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Human, C-His tag HG10773-CH
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Human, N-His tag HG10773-NH
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Human, C-HA tag HG10773-CY
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Human, N-HA tag HG10773-NY
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Human, C-Myc tag HG10773-CM
    Asialoglycoprotein Receptor 1 cDNA ORF Clone, Human, N-Myc tag HG10773-NM
    Asialoglycoprotein Receptor 1 qPCR Primer Pairs, Human HP100694
    info info
    添加购物车成功! 添加购物车失败!