p16 ARC/ARPC5 cDNA ORF Clone, Mouse, untagged

Cat: MG51500-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All p16 ARC/ARPC5 Reagents
CRO Services
Product recommended

All p16 ARC/ARPC5 Reagents
p16 ARC/ARPC5 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
456 bp
Description
Full length Clone DNA of Mouse actin related protein 2/3 complex, subunit 5.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

p16 ARC/ARPC5 cDNA ORF Clone, Mouse, untagged Alternative Names
5830443F10Rik cDNA ORF Clone, Mouse;p16-Arc cDNA ORF Clone, Mouse
p16 ARC/ARPC5 Background Information
Full Name
actin related protein 2/3 complex, subunit 5, 16kDa

p16 ARC/ARPC5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
p16 ARC/ARPC5 cDNA ORF Clone in Cloning Vector, Rat RG81242-U
p16 ARC/ARPC5 cDNA ORF Clone, Rat, untagged RG81242-UT
p16 ARC/ARPC5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81242-ACGLN
p16 ARC/ARPC5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81242-ACG
p16 ARC/ARPC5 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81242-ANG
p16 ARC/ARPC5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81242-ACR
p16 ARC/ARPC5 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81242-ANR
p16 ARC/ARPC5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81242-CF
p16 ARC/ARPC5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81242-NF
p16 ARC/ARPC5 cDNA ORF Clone, Rat, C-His tag RG81242-CH
p16 ARC/ARPC5 cDNA ORF Clone, Rat, N-His tag RG81242-NH
p16 ARC/ARPC5 cDNA ORF Clone, Rat, C-HA tag RG81242-CY
p16 ARC/ARPC5 cDNA ORF Clone, Rat, N-HA tag RG81242-NY
p16 ARC/ARPC5 cDNA ORF Clone, Rat, C-Myc tag RG81242-CM
p16 ARC/ARPC5 cDNA ORF Clone, Rat, N-Myc tag RG81242-NM
p16 ARC/ARPC5 qPCR Primer Pairs, Rat RP301198

p16 ARC/ARPC5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
p16 ARC/ARPC5 cDNA ORF Clone in Cloning Vector, Mouse MG51500-G
p16 ARC/ARPC5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51500-ACGLN
p16 ARC/ARPC5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51500-ACG
p16 ARC/ARPC5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51500-ANG
p16 ARC/ARPC5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51500-ACR
p16 ARC/ARPC5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51500-ANR
p16 ARC/ARPC5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51500-CF
p16 ARC/ARPC5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51500-NF
p16 ARC/ARPC5 cDNA ORF Clone, Mouse, C-His tag MG51500-CH
p16 ARC/ARPC5 cDNA ORF Clone, Mouse, N-His tag MG51500-NH
p16 ARC/ARPC5 cDNA ORF Clone, Mouse, C-HA tag MG51500-CY
p16 ARC/ARPC5 cDNA ORF Clone, Mouse, N-HA tag MG51500-NY
p16 ARC/ARPC5 cDNA ORF Clone, Mouse, C-Myc tag MG51500-CM
p16 ARC/ARPC5 cDNA ORF Clone, Mouse, N-Myc tag MG51500-NM
p16 ARC/ARPC5 qPCR Primer Pairs, Mouse MP201384

p16 ARC/ARPC5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
p16 ARC/ARPC5 cDNA ORF Clone in Cloning Vector, Human HG16494-G
p16 ARC/ARPC5 cDNA ORF Clone, Human, untagged HG16494-UT
p16 ARC/ARPC5 cDNA ORF Clone, Human, C-GFPSpark® tag HG16494-ACG
p16 ARC/ARPC5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16494-ACGLN
p16 ARC/ARPC5 cDNA ORF Clone, Human, C-OFPSpark® tag HG16494-ACR
p16 ARC/ARPC5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16494-CF
p16 ARC/ARPC5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16494-NF
p16 ARC/ARPC5 cDNA ORF Clone, Human, C-His tag HG16494-CH
p16 ARC/ARPC5 cDNA ORF Clone, Human, N-His tag HG16494-NH
p16 ARC/ARPC5 cDNA ORF Clone, Human, C-HA tag HG16494-CY
p16 ARC/ARPC5 cDNA ORF Clone, Human, N-HA tag HG16494-NY
p16 ARC/ARPC5 cDNA ORF Clone, Human, C-Myc tag HG16494-CM
p16 ARC/ARPC5 cDNA ORF Clone, Human, N-Myc tag HG16494-NM
info info
添加购物车成功! 添加购物车失败!