ARPC3/p21-ARC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52832-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ARPC3/p21-ARC Reagents
CRO Services
Product recommended

All ARPC3/p21-ARC Reagents
ARPC3/p21-ARC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
537 bp
Description
Full length Clone DNA of Mouse actin related protein 2>3 complex, subunit 3 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARPC3/p21-ARC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
1110006A04Rik cDNA ORF Clone, Mouse;21kDa cDNA ORF Clone, Mouse;AA408672 cDNA ORF Clone, Mouse;AI788639 cDNA ORF Clone, Mouse;p21-Ar cDNA ORF Clone, Mouse;p21Arc cDNA ORF Clone, Mouse
ARPC3/p21-ARC Background Information
Full Name
actin related protein 2/3 complex, subunit 3, 21kDa

ARPC3/p21-ARC cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ARPC3/p21-ARC cDNA ORF Clone in Cloning Vector, Mouse MG52832-G
ARPC3/p21-ARC cDNA ORF Clone, Mouse, untagged MG52832-UT
ARPC3/p21-ARC Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52832-ACGLN
ARPC3/p21-ARC cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52832-ACG
ARPC3/p21-ARC cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52832-ACR
ARPC3/p21-ARC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52832-NF
ARPC3/p21-ARC cDNA ORF Clone, Mouse, C-His tag MG52832-CH
ARPC3/p21-ARC cDNA ORF Clone, Mouse, N-His tag MG52832-NH
ARPC3/p21-ARC cDNA ORF Clone, Mouse, C-HA tag MG52832-CY
ARPC3/p21-ARC cDNA ORF Clone, Mouse, N-HA tag MG52832-NY
ARPC3/p21-ARC cDNA ORF Clone, Mouse, C-Myc tag MG52832-CM
ARPC3/p21-ARC cDNA ORF Clone, Mouse, N-Myc tag MG52832-NM

ARPC3/p21-ARC cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ARPC3/p21-ARC cDNA ORF Clone in Cloning Vector, Human HG15349-G
ARPC3/p21-ARC cDNA ORF Clone, Human, untagged HG15349-UT
ARPC3/p21-ARC cDNA ORF Clone, Human, C-GFPSpark® tag HG15349-ACG
ARPC3/p21-ARC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15349-ACGLN
ARPC3/p21-ARC cDNA ORF Clone, Human, N-GFPSpark® tag HG15349-ANG
ARPC3/p21-ARC cDNA ORF Clone, Human, C-OFPSpark® tag HG15349-ACR
ARPC3/p21-ARC cDNA ORF Clone, Human, N-OFPSpark® tag HG15349-ANR
ARPC3/p21-ARC cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15349-CF
ARPC3/p21-ARC cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15349-NF
ARPC3/p21-ARC cDNA ORF Clone, Human, C-His tag HG15349-CH
ARPC3/p21-ARC cDNA ORF Clone, Human, N-His tag HG15349-NH
ARPC3/p21-ARC cDNA ORF Clone, Human, C-HA tag HG15349-CY
ARPC3/p21-ARC cDNA ORF Clone, Human, N-HA tag HG15349-NY
ARPC3/p21-ARC cDNA ORF Clone, Human, C-Myc tag HG15349-CM
ARPC3/p21-ARC cDNA ORF Clone, Human, N-Myc tag HG15349-NM
ARPC3/p21-ARC qPCR Primer Pairs, Human HP103973
info info
添加购物车成功! 添加购物车失败!