Quick Order

Mouse CDNF/ARMETL1 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse CDNF cDNA Clone Product Information
NCBI RefSeq:NM_177647.4
RefSeq ORF Size:564bp
cDNA Description:Full length Clone DNA of Mus musculus arginine-rich, mutated in early stage tumors-like 1 with C terminal Myc tag.
Gene Synonym:CDNF, MGC129430, 9330140G23, Armetl1
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Cerebral Dopamine Neurotrophic Factor (CDNF), also known as ARMETL1 (ARMET-like protein 1), is a secreted protein with eight conserved cysteine residues, predicting a unique protein fold and defining a new, evolutionarily conserved protein family. CDNF is a novel neurotrophic factor with strong trophic activity on dopaminergic neurons comparable to that of glial cell line-derived neurotrophic factor (GDNF). CDNF/ARMETL1 is a evolutionary conserved protein which can protect and restore the function of dopaminergic neurons in the rat model of Parkinson's disease, suggesting that CDNF might be beneficial for the treatment of Parkinson's disease. CDNF is widely expressed in neurons in several brain regions including cerebral cortex, hippocampus, substantia nigra, striatum and cerebellum. Human CDNF is glycosylated and secreted from transiently transfected cells. CDNF promotes the survival, growth, and function of dopamine-specific neurons and is expressed in brain regions that undergo cocaine-induced neuroplasticity.

References
  • Choi JM, et al. (2011) Analysis of mutations and the association between polymorphisms in the cerebral dopamine neurotrophic factor (CDNF) gene and Parkinson disease. Neurosci Lett. 493(3): 97-101.
  • Sun ZP, et al. (2011) Intracellular trafficking and secretion of cerebral dopamine neurotrophic factor in neurosecretory cells. J Neurochem. 117(1): 121-32.
  • Lohoff FW, et al. (2009) Association analysis between polymorphisms in the conserved dopamine neurotrophic factor (CDNF) gene and cocaine dependence. Neurosci Lett. 453(3): 199-203.
  • Lindholm P, et al. (2007) Novel neurotrophic factor CDNF protects and rescues midbrain dopamine neurons in vivo. Nature. 448(7149): 73-7.
  • Size / Price
    Catalog: MG50569-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"