ARL4A/ARL4 cDNA ORF Clone, Mouse, C-His tag

Cat: MG52305-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ARL4A/ARL4 Reagents
CRO Services
Product recommended

All ARL4A/ARL4 Reagents
ARL4A/ARL4 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
603 bp
Description
Full length Clone DNA of Mouse ADP-ribosylation factor-like 4A
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARL4A/ARL4 cDNA ORF Clone, Mouse, C-His tag Alternative Names
AI467555 cDNA ORF Clone, Mouse;Arl4 cDNA ORF Clone, Mouse
ARL4A/ARL4 Background Information
Full Name
ADP-ribosylation factor-like 4A

ARL4A/ARL4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ARL4A/ARL4 cDNA ORF Clone in Cloning Vector, Rat RG86577-U
ARL4A/ARL4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86577-ACGLN

ARL4A/ARL4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ARL4A/ARL4 cDNA ORF Clone in Cloning Vector, Mouse MG52305-U
ARL4A/ARL4 cDNA ORF Clone, Mouse, untagged MG52305-UT
ARL4A/ARL4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52305-ACGLN
ARL4A/ARL4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52305-ACG
ARL4A/ARL4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52305-ANG
ARL4A/ARL4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52305-ACR
ARL4A/ARL4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52305-ANR
ARL4A/ARL4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52305-CF
ARL4A/ARL4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52305-NF
ARL4A/ARL4 cDNA ORF Clone, Mouse, N-His tag MG52305-NH
ARL4A/ARL4 cDNA ORF Clone, Mouse, C-HA tag MG52305-CY
ARL4A/ARL4 cDNA ORF Clone, Mouse, N-HA tag MG52305-NY
ARL4A/ARL4 cDNA ORF Clone, Mouse, C-Myc tag MG52305-CM
ARL4A/ARL4 cDNA ORF Clone, Mouse, N-Myc tag MG52305-NM
ARL4A/ARL4 qPCR Primer Pairs, Mouse MP202178

ARL4A/ARL4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ARL4A/ARL4 cDNA ORF Clone in Cloning Vector, Human HG17017-U
ARL4A/ARL4 cDNA ORF Clone, Human, untagged HG17017-UT
ARL4A/ARL4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17017-ACGLN
ARL4A/ARL4 cDNA ORF Clone, Human, C-GFPSpark® tag HG17017-ACG
ARL4A/ARL4 cDNA ORF Clone, Human, C-OFPSpark® tag HG17017-ACR
ARL4A/ARL4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17017-CF
ARL4A/ARL4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17017-NF
ARL4A/ARL4 cDNA ORF Clone, Human, C-His tag HG17017-CH
ARL4A/ARL4 cDNA ORF Clone, Human, N-His tag HG17017-NH
ARL4A/ARL4 cDNA ORF Clone, Human, C-HA tag HG17017-CY
ARL4A/ARL4 cDNA ORF Clone, Human, N-HA tag HG17017-NY
ARL4A/ARL4 cDNA ORF Clone, Human, C-Myc tag HG17017-CM
ARL4A/ARL4 cDNA ORF Clone, Human, N-Myc tag HG17017-NM
info info
添加购物车成功! 添加购物车失败!