ARL2BP cDNA ORF Clone, Mouse, N-His tag

Cat: MG51420-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ARL2BP Reagents
CRO Services
Product recommended

All ARL2BP Reagents
ARL2BP cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
492 bp
Description
Full length Clone DNA of Mouse ADP-ribosylation factor-like 2 binding protein with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARL2BP cDNA ORF Clone, Mouse, N-His tag Alternative Names
1700010P10Rik cDNA ORF Clone, Mouse;1700027H16Rik cDNA ORF Clone, Mouse;6330544B05Rik cDNA ORF Clone, Mouse;AI482273 cDNA ORF Clone, Mouse;AI849834 cDNA ORF Clone, Mouse;BART cDNA ORF Clone, Mouse;Bart1 cDNA ORF Clone, Mouse
ARL2BP Background Information

ADP-ribosylation factor (ARF)-like proteins (ARLs) comprise a functionally distinct group of the ARF family of RAS-related GTPases. ARL2BP binds to ARL2.GTP with high affinity but does not interact with ARL2.GDP, activated ARF, or RHO proteins. The lack of detectable membrane association of ARL2BP or ARL2 upon activation of ARL2 is suggestive of actions distinct from those of the ARFs. ARL2BP is considered to be the first ARL2-specific effector identified, due to its interaction with ARL2.GTP but lack of ARL2 GTPase-activating protein activity. ARL2BP, together with ARL2, plays a role in the nuclear translocation, retention and transcriptional activity of STAT3. ARL2BP may play a role as an effector of ARL2.

Full Name
ADP-ribosylation factor-like 2 binding protein
References
  • Qiu J. et al., 2011, PLoS Pathog. 7 (8): e1002193.
  • Taniuchi K. et al., 2012, PLoS One. 7 (4): e35674.
  • Taniuchi K. et al., 2012, Neoplasia. 14 (5): 440-50.
  • ARL2BP cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    ARL2BP cDNA ORF Clone in Cloning Vector, Rat RG81551-G

    ARL2BP cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ARL2BP cDNA ORF Clone in Cloning Vector, Mouse MG51420-G
    ARL2BP cDNA ORF Clone, Mouse, untagged MG51420-UT
    ARL2BP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51420-ACG
    ARL2BP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51420-ACGLN
    ARL2BP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51420-ANG
    ARL2BP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51420-ACR
    ARL2BP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51420-ANR
    ARL2BP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51420-CF
    ARL2BP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51420-NF
    ARL2BP cDNA ORF Clone, Mouse, C-His tag MG51420-CH
    ARL2BP cDNA ORF Clone, Mouse, C-HA tag MG51420-CY
    ARL2BP cDNA ORF Clone, Mouse, N-HA tag MG51420-NY
    ARL2BP cDNA ORF Clone, Mouse, C-Myc tag MG51420-CM
    ARL2BP cDNA ORF Clone, Mouse, N-Myc tag MG51420-NM
    ARL2BP qPCR Primer Pairs, Mouse MP201304

    ARL2BP cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ARL2BP cDNA ORF Clone in Cloning Vector, Human HG14357-G
    ARL2BP cDNA ORF Clone, Human, untagged HG14357-UT
    ARL2BP cDNA ORF Clone, Human, C-GFPSpark® tag HG14357-ACG
    ARL2BP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14357-ACGLN
    ARL2BP cDNA ORF Clone, Human, N-GFPSpark® tag HG14357-ANG
    ARL2BP cDNA ORF Clone, Human, C-OFPSpark® tag HG14357-ACR
    ARL2BP cDNA ORF Clone, Human, N-OFPSpark® tag HG14357-ANR
    ARL2BP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14357-CF
    ARL2BP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14357-NF
    ARL2BP cDNA ORF Clone, Human, C-His tag HG14357-CH
    ARL2BP cDNA ORF Clone, Human, N-His tag HG14357-NH
    ARL2BP cDNA ORF Clone, Human, C-HA tag HG14357-CY
    ARL2BP cDNA ORF Clone, Human, N-HA tag HG14357-NY
    ARL2BP cDNA ORF Clone, Human, C-Myc tag HG14357-CM
    ARL2BP cDNA ORF Clone, Human, N-Myc tag HG14357-NM
    ARL2BP qPCR Primer Pairs, Human HP103006
    info info
    添加购物车成功! 添加购物车失败!