RhoGDI/ARHGDIA cDNA ORF Clone, Mouse, untagged

Cat: MG52485-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RhoGDI/ARHGDIA Reagents
CRO Services
Product recommended

All RhoGDI/ARHGDIA Reagents
RhoGDI/ARHGDIA cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
615 bp
Description
Full length Clone DNA of Mouse Rho GDP dissociation inhibitor (GDI) alpha.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RhoGDI/ARHGDIA cDNA ORF Clone, Mouse, untagged Alternative Names
5330430M07Rik cDNA ORF Clone, Mouse;Gdi-1 cDNA ORF Clone, Mouse;Rho-GDI cDNA ORF Clone, Mouse;RhoDGI cDNA ORF Clone, Mouse;RhoGDI-1 cDNA ORF Clone, Mouse
RhoGDI/ARHGDIA Background Information
Full Name
Rho GDP dissociation inhibitor (GDI) alpha

RhoGDI/ARHGDIA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RhoGDI/ARHGDIA cDNA ORF Clone in Cloning Vector, Rat RG81421-G

RhoGDI/ARHGDIA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RhoGDI/ARHGDIA cDNA ORF Clone in Cloning Vector, Mouse MG52485-G
RhoGDI/ARHGDIA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52485-ACGLN
RhoGDI/ARHGDIA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52485-ACG
RhoGDI/ARHGDIA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52485-ANG
RhoGDI/ARHGDIA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52485-ACR
RhoGDI/ARHGDIA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52485-ANR
RhoGDI/ARHGDIA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52485-CF
RhoGDI/ARHGDIA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52485-NF
RhoGDI/ARHGDIA cDNA ORF Clone, Mouse, C-His tag MG52485-CH
RhoGDI/ARHGDIA cDNA ORF Clone, Mouse, N-His tag MG52485-NH
RhoGDI/ARHGDIA cDNA ORF Clone, Mouse, C-HA tag MG52485-CY
RhoGDI/ARHGDIA cDNA ORF Clone, Mouse, N-HA tag MG52485-NY
RhoGDI/ARHGDIA cDNA ORF Clone, Mouse, C-Myc tag MG52485-CM
RhoGDI/ARHGDIA cDNA ORF Clone, Mouse, N-Myc tag MG52485-NM
RhoGDI/ARHGDIA qPCR Primer Pairs, Mouse MP202358

RhoGDI/ARHGDIA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RhoGDI/ARHGDIA cDNA ORF Clone in Cloning Vector, Human HG14671-G
RhoGDI/ARHGDIA cDNA ORF Clone, Human, untagged HG14671-UT
RhoGDI/ARHGDIA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14671-ACGLN
RhoGDI/ARHGDIA cDNA ORF Clone, Human, C-GFPSpark® tag HG14671-ACG
RhoGDI/ARHGDIA cDNA ORF Clone, Human, N-GFPSpark® tag HG14671-ANG
RhoGDI/ARHGDIA cDNA ORF Clone, Human, C-OFPSpark® tag HG14671-ACR
RhoGDI/ARHGDIA cDNA ORF Clone, Human, N-OFPSpark® tag HG14671-ANR
RhoGDI/ARHGDIA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14671-CF
RhoGDI/ARHGDIA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14671-NF
RhoGDI/ARHGDIA cDNA ORF Clone, Human, C-His tag HG14671-CH
RhoGDI/ARHGDIA cDNA ORF Clone, Human, N-His tag HG14671-NH
RhoGDI/ARHGDIA cDNA ORF Clone, Human, C-HA tag HG14671-CY
RhoGDI/ARHGDIA cDNA ORF Clone, Human, N-HA tag HG14671-NY
RhoGDI/ARHGDIA cDNA ORF Clone, Human, C-Myc tag HG14671-CM
RhoGDI/ARHGDIA cDNA ORF Clone, Human, N-Myc tag HG14671-NM
RhoGDI/ARHGDIA qPCR Primer Pairs, Human HP103305
info info
添加购物车成功! 添加购物车失败!