Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Mouse, N-His tag

Cat: MG51972-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Arf6/ADP-ribosylation factor 6 Reagents

CRO Services

Product recommended


All Arf6/ADP-ribosylation factor 6 Reagents

Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
528 bp
Description
Full length Clone DNA of Mouse ADP-ribosylation factor 6 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Mouse, N-His tag Alternative Names

AI788669 cDNA ORF Clone, Mouse;AW496366 cDNA ORF Clone, Mouse

Arf6/ADP-ribosylation factor 6 Background Information

Full Name
ADP-ribosylation factor 6

Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone in Cloning Vector, Mouse MG51972-G
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Mouse, untagged MG51972-UT
Arf6/ADP-ribosylation factor 6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51972-ACGLN
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51972-ACG
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51972-ANG
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51972-ACR
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51972-ANR
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51972-CF
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51972-NF
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Mouse, C-His tag MG51972-CH
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Mouse, C-HA tag MG51972-CY
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Mouse, N-HA tag MG51972-NY
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Mouse, C-Myc tag MG51972-CM
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Mouse, N-Myc tag MG51972-NM
Arf6/ADP-ribosylation factor 6 qPCR Primer Pairs, Mouse MP201845

Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone in Cloning Vector, Human HG14984-G
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Human, untagged HG14984-UT
Arf6/ADP-ribosylation factor 6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14984-ACGLN
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Human, C-GFPSpark® tag HG14984-ACG
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Human, C-OFPSpark® tag HG14984-ACR
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14984-CF
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14984-NF
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Human, C-His tag HG14984-CH
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Human, N-His tag HG14984-NH
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Human, C-HA tag HG14984-CY
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Human, N-HA tag HG14984-NY
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Human, C-Myc tag HG14984-CM
Arf6/ADP-ribosylation factor 6 cDNA ORF Clone, Human, N-Myc tag HG14984-NM
Arf6/ADP-ribosylation factor 6 qPCR Primer Pairs, Human HP103612
info info
添加购物车成功! 添加购物车失败!