ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, untagged

Cat: MG51638-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ARF2/ADP-ribosylation factor 2 Reagents
CRO Services
Product recommended

All ARF2/ADP-ribosylation factor 2 Reagents
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
546 bp
Description
Full length Clone DNA of Mouse ADP-ribosylation factor 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARF2/ADP-ribosylation factor 2 Background Information
Full Name
ADP-ribosylation factor 4

ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone in Cloning Vector, Rat RG80970-U
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, untagged RG80970-UT
ARF2/ADP-ribosylation factor 2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80970-ACGLN
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80970-ACG
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80970-ACR
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80970-CF
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80970-NF
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, C-His tag RG80970-CH
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, N-His tag RG80970-NH
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, C-HA tag RG80970-CY
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, N-HA tag RG80970-NY
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, C-Myc tag RG80970-CM
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, N-Myc tag RG80970-NM
ARF2/ADP-ribosylation factor 2 qPCR Primer Pairs, Rat RP300934

ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone in Cloning Vector, Mouse MG51638-G
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51638-ACG
ARF2/ADP-ribosylation factor 2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51638-ACGLN
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51638-ANG
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51638-ACR
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51638-ANR
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51638-CF
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51638-NF
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, C-His tag MG51638-CH
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, N-His tag MG51638-NH
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, C-HA tag MG51638-CY
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, N-HA tag MG51638-NY
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, C-Myc tag MG51638-CM
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, N-Myc tag MG51638-NM
ARF2/ADP-ribosylation factor 2 qPCR Primer Pairs, Mouse MP201511
info info
添加购物车成功! 添加购物车失败!