Aprataxin/APTX cDNA ORF Clone, Mouse, N-His tag

Cat: MG50765-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Aprataxin/APTX Reagents
CRO Services
Product recommended

All Aprataxin/APTX Reagents
Aprataxin/APTX cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1008 bp
Description
Full length Clone DNA of Mouse aprataxin with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Aprataxin/APTX cDNA ORF Clone, Mouse, N-His tag Alternative Names
2410016G21Rik cDNA ORF Clone, Mouse;AA388047 cDNA ORF Clone, Mouse;FHA-HIT cDNA ORF Clone, Mouse
Aprataxin/APTX Background Information
Full Name
aprataxin

Aprataxin/APTX cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Aprataxin/APTX cDNA ORF Clone in Cloning Vector, Mouse MG50765-G
Aprataxin/APTX cDNA ORF Clone, Mouse, untagged MG50765-UT
Aprataxin/APTX cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50765-ACG
Aprataxin/APTX Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50765-ACGLN
Aprataxin/APTX cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50765-ANG
Aprataxin/APTX cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50765-ACR
Aprataxin/APTX cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50765-ANR
Aprataxin/APTX cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50765-CF
Aprataxin/APTX cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50765-NF
Aprataxin/APTX cDNA ORF Clone, Mouse, C-His tag MG50765-CH
Aprataxin/APTX cDNA ORF Clone, Mouse, C-HA tag MG50765-CY
Aprataxin/APTX cDNA ORF Clone, Mouse, N-HA tag MG50765-NY
Aprataxin/APTX cDNA ORF Clone, Mouse, C-Myc tag MG50765-CM
Aprataxin/APTX cDNA ORF Clone, Mouse, N-Myc tag MG50765-NM
Aprataxin/APTX qPCR Primer Pairs, Mouse MP200739

Aprataxin/APTX cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Aprataxin/APTX cDNA ORF Clone in Cloning Vector, Human HG10454-M
Aprataxin/APTX cDNA ORF Clone, Human, untagged HG10454-UT
Aprataxin/APTX cDNA ORF Clone, Human, C-GFPSpark® tag HG10454-ACG
Aprataxin/APTX Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10454-ACGLN
Aprataxin/APTX cDNA ORF Clone, Human, N-GFPSpark® tag HG10454-ANG
Aprataxin/APTX cDNA ORF Clone, Human, C-OFPSpark® tag HG10454-ACR
Aprataxin/APTX cDNA ORF Clone, Human, N-OFPSpark® tag HG10454-ANR
Aprataxin/APTX cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10454-CF
Aprataxin/APTX cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10454-NF
Aprataxin/APTX cDNA ORF Clone, Human, C-His tag HG10454-CH
Aprataxin/APTX cDNA ORF Clone, Human, N-His tag HG10454-NH
Aprataxin/APTX cDNA ORF Clone, Human, C-HA tag HG10454-CY
Aprataxin/APTX cDNA ORF Clone, Human, N-HA tag HG10454-NY
Aprataxin/APTX cDNA ORF Clone, Human, C-Myc tag HG10454-CM
Aprataxin/APTX cDNA ORF Clone, Human, N-Myc tag HG10454-NM
Aprataxin/APTX qPCR Primer Pairs, Human HP100483
info info
添加购物车成功! 添加购物车失败!